Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2077
Contig Information
Length 1041 bp
Tissue Shoot grown with dessication
Clones 7 Clones [Download: CSV  ,  FASTA ]
whsd10c09    whsd10l16    whsd3g09    whsd11h19    rwhsd10c09    rwhsd10l16    rwhsd3g09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|50878377|gb|AAT85152.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|50878430|gb|AAT85204.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579044|dbj|BAF17407.1| Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|215697746|dbj|BAG91740.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196770|gb|EEC79197.1| hypothetical protein OsI_19905 [Oryza sativa Indica Group]
Score 993
Evalue 1.10377e-105
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2077
AACCGCGTCCCAACCGAAATCCCCAATTCCCCACCACCGACAGCGTCGGTGAGAGAGATGGCGTCGGCGACGGAGATGCAGCCGCTGGCACCGTCGGGCT
ACCGCCGGGCGCCGGAGATGAAGGAGAAGGTGGAGGCGTCGTCGATCGACCTGGAGGCGGGGAACGGGGAGACGCTCTACCCGGGGATCTCGCGCGGGGA
GAACGCCCTCCGCTGGGGCTTCATCCGCAAGGTCTACGGCATCCTCTGCGCGCAGCTGGTCCTCACCACCGTCGTCTCCGCCATCACCGTCTTCTACCCC
ACCCTCAACGCCACGCTCTCCAACTCGCCCGTCCTCGCGCTCGTGCTCGCCGTCCTCCCCTTCATCCTGATGATCCCATTGTACATCTATCAGCACAGAC
ACCCTCACAATCTTGCTATCTTGGGTTTGTTCACTCTGTGCTTGAGCTTCAGCATTGGTGTGGCTTGTGCAAACACTGAAGGAACTATTGTGCTTCAAGC
ATTGGTACTGACCTCAGCTGTGGTTGTCTCTCTGACTGCATACACATTCTGGGCCGCAAAGAAGGGCAAGGAATTTAGTTACCTTGGACCGTTTCTGTTT
TCTGCTCTCACCATCCTGGTCGTGATAAGCTTTACCCAGATCTTCTTCCCATTTGGACCTGCATCGAATGCTGTGATCGGTGGGTTTGGAGCTCTAGTCT
TCTCAGGCTTCATCGTCTACGACACTGAGAACTTGATAAAGCGCCACACTTATGACGAGTACATCTGGGCGTCTGTTGAGCTTTACCTCGACATCCTCAA
CCTGTTCCTGACCATCCTACAGATGCTCAGGCAGAATGACAACTGATGGGTCCTGTCTGAACCACCAGGACCTTGTGCCAACCCAGGCATATGTCCAACA
TTTATCAAGTCTTTTGAATTGCTATCTACATAACTTGGAAGACATGGTAGTAAGTTTTTGCCATCATCCAGAGATGAGGCCAAAGTACAACCATATGTAT
AGGTGTTCTATTGTGAGTTTATGTGCCTGAGTGTTGTAAAC
page-top