Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2059
Contig Information
Length 734 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd10d24    whsd3k10    whsd11f10    rwhsd10d24    rwhsd11f10    rwhsd3k10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 384
Evalue 2.50937e-35
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2059
CCCATTCCGATCCCCCTCCCGGCGCCGCCTCCAGCCTAGGGTTTCCTCCCGCCGCCCGTCCGCCCCACCCGCCGCCATGGCCCGCCGCAGCGGAGGAGGA
AGGTCTTCCCGCCCTGCTCCACGTGCTGCTCCAGTGAGAAACCCACCAGCGCCAGCCCGTCCAGCTCCTCCACCTGCTACCACCCAGAGCAGCGGTGGTG
GTATCATGAGCGGGATTGGGTCCACCATTGCTCAGGGCATGGCTTTCGGTACTGGAAGTGCCATGGCGCACAGGGCTGTTGATGCTGTGATGGGTCCCCG
TACCATTCAGCATGAGACTGTTGTCGGTGAGGCTGCTGCATCTATGACTCCAATGGACAATGCTGCTGATGACAAGTGTGGCAACCCTTCCAAGGCCTTC
CAAGATTGCATCAACCACTACGGAAGCGATATCAGCAAGTGCCAGTTCTACCTTGACATGCTGAACGAGTGCCGCCGTGGAGGAGCAACTCTTTAAGCTA
CTATCTTTGCTTGATTGGGGCTTAATTGGGCAGAACCTGTTTTCAGTCATGATGATGATGATATATATCTCCTAAATAATTCATTGGCAATATTATGAAC
CTATGCCACAGCTTGTGTCTATTACCTACCCTAGTTCGTGGTCTCTGTTGTCCCGGGAGTATTTCCTTGTATTGATGTTGGAATTACCTTCATGGCAGTG
GGTTTATAAATATGGAGTTTGAACAAAAAAAAAA
page-top