Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2045
Contig Information
Length 1004 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd1d04    whsd1f02    whsd4d12    rwhsd10g21    rwhsd1d04    rwhsd4d12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1248
Evalue 2.82221e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2045
AATCTCGACCTCCCCCTCTCCCGTCCGCCCGTCGTCCCCAACCCGATCCGATCTCCCCCCTCCTCCGTCGCCATGGGCCGCAAGTTCTTCGTCGGCGGCA
ACTGGAAATGCAATGGAACTGTGGAACAGGTAGAGAGTATCGTCAACACTCTGAACGCTGGACAGATCGCCTCTACGGATGTTGTCGAGGTTGTCGTCAG
CCCGCCCTATGTCTTCCTTCCCACCGTCAAGGGTAAGCTGCGCCCAGAGATCCAAGTCGCTGCTCAGAACTGCTGGGTGAAGAAGGGCGGTGCTTTCACC
GGTGAAGTCAGTGCTGAGATGCTTGTCAACCTCGGCGTTCCCTGGGTCATCCTTGGACACTCTGAAAGGAGGAGCTTGATGGGAGAATCAAGCGAGTTTG
TTGGAGAGAAGGTTGCATATGCACTTGCTCAGGGCTTGAAGGTCATTGCATGTGTTGGTGAGACTCTCGAGCAGCGAGAAGCTGGATCAACCATGGCAGT
TGTCGCTGAACAGACAAAAGCAATTGCTGACAAGATCAAGGACTGGACCAATGTGGTTGTCGCTTACGAACCAGTGTGGGCCATTGGCACCGGTAAAGTT
GCGACACCGGCTCAGGCGCAGGAAGTCCATGCCAATCTGAGGGACTGGCTCAAGACCAATGTGAGCCCCGAGGTTGCTGAATCCACGAGGATCATCTATG
GAGGATCTGTAACTGGCGCAAGCTGCAAGGAGTTGGCAGGGCAGCCCGACGTTGATGGTTTCCTCGTTGGTGGAGCTTCTTTGAAGCCTGAGTTCATTGA
CATCATCAACGCCGCCACTGTGAAGTCCGCCTAAGAAAAATCTTGATGTGGCTCCTCTCGGTGCGGAGGAAGACAGCGAAGATGAAGAGACTCCTTTTTT
CTCCTGTGTTTATTATGTGTGTACTATGCTAGTAATTTTGTGGTGGAGCAGCTGCTACTGTTTTCCTCCCCCCCTGACTTGAGCTTGCAAGCCAATAATG
ATAA
page-top