Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2042
Contig Information
Length 682 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd10c11    whsd5c07    whsd15p11    rwhsd10c11    rwhsd5c07    rwhsd15p11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit non-specific lipid transfer protein 1 precursor [Triticum aestivum] >gi|94315723|gb|ABF14724.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 377
Evalue 1.40277e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2042
TTTTTTTTTTGGAGCTGATCAGCTGAGTATACAATCCATATATCAAAATTACACATGGTACAAAGTACAGCATACTCGGGGAGTGGAGGAACAACCAAAC
TCGGGCCGGCCATGCAGAGCTGCTTGACGTACGTACTTCTCTCTCTCTCACGCAATGAGATAATATGAGAGCATTTGTTCATATATATGTGTGTGTGTGC
GTGTGTGTGACCTCAACATACTAAGCGTAGATCCAGCAACGATGGCGCAGGGGACGATGGCAACAGCGATGGCAGCAAGTGCTCGATCAGCGAATCTTAG
AGCAGTCGACCGAAGAGCTGATGGCGTAGGGGACGCTAACGCCGCACTTTGTGGGGATGCCCGCGGCCTTGCCAGCGTTGAGCCCAGCAGCAGCGCTCTT
GATACACTTGCACGCCACTTGCTTGTCAGCGGTGCTCCGGGCTGAGCTGGCTAGACTCCTAACGCCGCTGCAGCAGGCCGCAGACGGGTTGGCGCCGTTG
CCGCGTGCATAGGAGATGCAGGGGCTCAAGGCAGAGCTCACCTGACCGCACGATACGGCCGCCTCCGTGGCTGCGAGGAGCATAGCGGCCACCACGGCGA
CGAGCACGACCTGAGCAACAGCAGAATGGGCCATCACGATCAAGCTAGCTAGCACTAGTAGTGGTGGTGAGCTCATGCAGAG
page-top