Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2039
Contig Information
Length 1397 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd10e05    whsd8k21    whsd17n09    rwhsd10e05    rwhsd8k21    rwhsd17n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193449 [Zea mays] >gi|194693270|gb|ACF80719.1| unknown [Zea mays]
Score 1489
Evalue 5.14073e-163
Total Hit Count 293
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2039
AATCGGTTGAGCGTCGATAGCCTAACGACCTACACAACATGAAGCAAATATCAAATACAATTGGTTATCTCAAGATGCTTCACAAGCGTCTAAGGAAAAA
AATGTCTCACAAGAGGGCCGAAATGAAAATATGGTCAAAAGTCAGCAATCCAGCATTTCAGTGATTGTATCTAACCAGATTGCTATGAAAAAGGCGTAAC
AAGTGACAGCGCCACGGTACATTGGAACTGCACTGCACGCTCTCCTGGAGAGTTATATACAGCATAACAGGATGCCAAATTGCTAATTCTTGCAACACCA
TTCAGGCCAGGTTCCCAGCGGTTGAAGTTTATGAAGGCTGTGGAGTTTCGTCAAGGCGGAACATGTTTATCTCTTGCTGCTTGAAGTATCTCCGGTCTTC
CTCGTCCACAAGGACCAGGTTGAGGTAGTACTTGACACTGAACTTGTTGTTTATGTTGCGGTAAGTCGGGGTTAGCTCGTATGGAGTCAAGAATAGCCTT
ACAGGAATAGACTCTCCTCTGACTGGGGCACCATCCATCAGCTCAAATTTAGCAAGTGTCTCAGTCTCAACATATGTGTTAGGACCTGATCCTGTTGATT
CCCGGCGGCGAATCTCAAGCTCCATGTTTTTTATCTTTATTCTGACTAGAAGAAAATAGATCTTTCCTACAATGACATCCTTGAGATGGTACTTGCTTTT
GCTGTACTCAAACTCAATATGCAGGCAATCTTCAATTCCAACTTCCATCTTGATGCTGTTATTGATTGAAGGAAGAGGAGAATAGTTCCTTACACAGAAA
TCCCGAGATTCCACAATATTACCAACATAGTTTCTACCAATCGTCACTTTCAGGATGTACCTCAGTCTGACATTTGTTCCATTGTATGACTCATATGGCA
TTTCAACAGTAGAGAACTCAAATGGATATGTCTTTCTTTCATATATTTCACCAGGAACATCTAACTCACGCACCAGTGAAGTGAAGTCATAGAAGTTGCC
TCTGTCGAAATACAACTCTATCTGTCCAAGCAGCTCAATCTTAACACCCATGTGCTCAATCCTTTTACCAGGAACAGGCGCTATTGATACCTCTCCGGCT
ATGGTCTCCAGGCTCTGGAACGCCGGCACCATGGTTGTCTTCCCATTATCCTTCTTGACTGCAACCTGCTTCCGGCTCCTCTCATCGGAAAAGGTCACGA
AGATGTCGCAGGGCGGCTTGAAGGCGCCGATGATGTAATTCATGGCTGCGTCGGAACAGAAGAAAAGGTGGATGTGGAGGGCGACGCGGGGACGATAGCC
GAGGAAGGTCGCCCACGCCGGAGGAGGGGATCACCGGTGTTGTTGGAGCTGGGCGTCAACTGCCGGGTCGGGCTTCAGGAGAGAGGAAGAGAGAGGA
page-top