Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig2002
Contig Information
Length 1348 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd10d18    whsd6o12    whsd19o06    rwhsd10d18    rwhsd19o06    rwhsd6o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0501700 [Oryza sativa (japonica cultivar-group)] >gi|13442818|dbj|BAB39766.1| OsTATC [Oryza sativa Japonica Group] >gi|15408654|dbj|BAB64068.1| putative TatC [Oryza sativa Japonica Group] >gi|113532664|dbj|BAF05047.1| Os01g0501700 [Oryza sativa (japonica cultivar-group)] >gi|215695165|dbj|BAG90356.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188286|gb|EEC70713.1| hypothetical protein OsI_02087 [Oryza sativa Indica Group]
Score 1057
Evalue 3.7319e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig2002
CTGGCGGAAGCGAGCAGAAAATTATCGGTTTATCACCTATCGAGCTCCCGCGAGAGACGATGGGAAGCGCAGGAGCGCTGCTCTCCCACCCCCCACCGCA
ACTCGGCAGCATCCTCCTCCGTCGCCACCACATCTCTCTTCCCCATCTCTCCTCATGCATGCCCGAGCCCCTCCACTGCCGCCGCCGGCACCTTCGCTGT
TCCGCCGTTGAGGGGAGCAGCAGACAGGACACGAATTTGCCAGCGTCTCAAAGAGAAGAGTCTCCATCGAGCAGCCTCGGCGCCACCCTCCAAGATCCAC
TTCCAGGACGTGCTCAAATGTATCTTGTACAGTCGAAAATGGTTCTTTTGAAGGTGTCACACAGGAAGAAGATCAGAGTAGTCTATATAATTTTCTTTAT
CCAAGCAAAGAGCTACTTCCAGATGATAAGGAAATGAGTATATTTGATCATCTAGAGGAACTTCGTGCGAGGATATTTATATCAGTATTGGCTGTTGGAG
CTTCAATAATTGGTTGTTTTGCTTTCTCCAAAGATATAATTAAGATTCTTGAAGCGCCTGTTAGTGTTCAGGGTGTCAGATTTTTGCAGCTCTCCCCTGG
AGAATTTTTCTTTACAACATTGAAGGTCTCTGGTTATTGTGGCCTCCTAATCGGAAGTCCTATAATTTTGTACGAGATCATAGCATTTGTTCTCCCTGGT
TTAACCAAGGATGAGCGGAAATTCCTAGGGCCCATTGTTTTGGGTTCTTCAGTTCTGTTCTACCTTGGCATTTTATTCTCCTACACTGTTCTTGCTCCAG
CAGCATTGAACTTCTTCGTGAATTATGCCGAAGGAGCGGTTGAATCGATATGGTCAATAGACCAGTACTTTGAGTTCGTACTTGTGCTTCTGTTCAGCAC
AGGATTATCCTTTCAGGTTCCTGTGATCCAGCTGTTGCTGGGGCAAGTTGGACTGGTTTCCAGCGAACAAATGCTTTCAATCTGGAGGTATGTTGTTGTT
GGTGCGGTGGTTGCTGCGGCTGTGCTTACGCCCTCGACTGATCCCTTGACTCAGATGCTTTTGGCGGGTCCACTGCTTGGTCTGTACTTGGGTGGTGCGT
GGATGGTCAGGCTAACTGGGCGCTAACTGCAACAAGCGTTGTAGTGATTGGGTATTGTGTGTTAGTGTACTACTAGAAATCATAGCCGTGTTGATTGGTC
CGAGTGGTCACCGTCCCCCACTGTAACATAGTCTTGTATAAAATTAACTCGGCTGCTTCTCATCTACGAGCACATTATTTGGCCCTCTTTCTCAATACGT
GGAGGCCATCTGTGAAGCCAGTATGACTATACCTTGCCGAAGTATTGC
page-top