Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1997
Contig Information
Length 685 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd10f03    whsd10f04    whsd10l05    rwhsd10f03    rwhsd10f04    rwhsd10l05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os10g05420 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 86
Evalue 0.31426
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1997
GGAGAGCTCAGGAGGAGGAGGAGAGCTAATAGGCGATGGATTCCCATGCGATGGCCGGCGACGACCGCCGGAGCACCGACCTCAACAAGCACGCTGTGGA
CAAGCAATCTCCTCAGCGACCCGCGGGCAGCAAGGCAGCTGGCGCTCCATGCGTCTACTTGAAGAAAGGCACGTGCGCGGAGGGGAGCATCCGGCATGAC
GCCCACGGCCATGCGCCACACCTCGCTGCGAACCATGCTCACTGAGCGTACCGTATAGCAGCAGCAGCAGCAGAGACGATACTACCGTACAATACTACTA
CGTGCTACGTACTATCTACGTATTTCCGTTTCGTCATGGCTTCCGCCGCCGCCGCCGCCGCTGCTAGTATACTAAAAAGAAAGTTTGTAATAATGAACGA
CTGTCCATGCGGTTCTTGTGATTGCGGGGTACGGACTTCCGGGCTTCTCAAGTTCGCCGTCCGCCCCACGTAGATTCCTGCCAGCTCCTTAAGACGGCGA
GGTTATGGTTTCCTACTCATGCGTACGCGCAGACGAGATTACTTGGTGTCAGATTCAAGGCTTCATCGACGACTGTGGCTCCTTCAGAGGCCTTGCTGTA
ATGCTTATCGTACTTGGGGTGCTTTGTACTTCTGATGAACCTTTTAATAAAGATGTTTTTAAAATAAAATAAAATAAAAAAAAAA
page-top