Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1987
Contig Information
Length 839 bp
Tissue Shoot grown with dessication
Clones 6 Clones [Download: CSV  ,  FASTA ]
whsd2l09    whsd14e10    whsd19g04    rwhsd14e10    rwhsd19g04    rwhsd2l09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cytochrome b6-f complex iron-sulfur subunit, chloroplastic; AltName: Full=Rieske iron-sulfur protein; Short=RISP; Short=ISP; AltName: Full=Plastohydroquinone:plastocyanin oxidoreductase iron-sulfur protein; Flags: Precursor >gi|32394644|gb|AAM88439.1| putative Rieske Fe-S precursor protein [Triticum aestivum]
Score 1117
Evalue 3.23995e-120
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1987
GCTCGCTCGATCGTCCTCTCCGCCGTGACGCAGCCAGTTCGCCATGGCCTCCACCGCGCTCTCCACCGCCTCCAACCCTACCCAGCTCTGCCGGACCCGC
GCAAGCTCGCTGTGCAAGCCCGTCAAGGGCCTGGGCTTCGGCCGGGAGCGCGTCCCGAGGAACATCACCTGCATGGCCGGCAGCATCTCCGCGGACCGCG
TGCCGGACATGAGCAAGAGGGAGCTGATGAACCTGCTCCTGCTGGGCGCCATCTCGCTCCCCACCTTCGGCATGCTCGTCCCCTACGGCTCCTTCCTCGT
CCCGGCCGGCTCCGGGAGCAACGCCGGAGGGGTCGCCGCCAAGGACAAGCTCGGCAACGACATCCTCGTCGAGGACTGGCTCAAGACGCACGGCCCCAAC
GACCGCACGCTCGCCCAGGGGCTCAAGGGTGATCCTACCTACCTTGTGGTGGAGTCCGACAAGACCCTCGCCACCTACGGGATCAACGCCGTGTGCACGC
ATCTTGGATGCGTCGTGCCGTGGAACGCCGCCGAGAACAAGTTCCTCTGCCCCTGCCATGGATCCCAGTACAACAACCAGGGCAAGGTTGTCCGTGGGCC
TGCACCTCTGTCGCTGGCCCTGGTTCACGCCGACGTCGACGACGGCAAGGTCGTCTTCGTGCCGTGGGTGGAGACCGACTTCAGGACCGGCGACAACCCG
TGGTGGAAATAAGCGACGCAAGCTCCGGCAGCAATGCTCACTCCTGTGATATGTTAAGCCTCCTGCCAGTCCTAAGAACGCTGCTACATAAGACTACTCC
TGCTATAAATGCACCTGTTTCTTGTATCCAGTTATATGT
page-top