Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1926
Contig Information
Length 1285 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsd1e11    whsd4e08    rwhsd1e11    rwhsd4e08    rwhsd4k08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|23237931|dbj|BAC16504.1| unknown protein [Oryza sativa Japonica Group] >gi|113611804|dbj|BAF22182.1| Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|215696974|dbj|BAG90968.1| unnamed protein product [Oryza sativa Japonica Group]
Score 746
Evalue 6.57793e-77
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1926
ATATGAATCCATTACAATCACTTGCTTTTACAAATCAAGGATAAAACTCAATGACAATACGGAATGATCAGAGTTTACATATAGGATACAAATATGTTTC
TTTGCACTAACTTTTTTTCCTTAGCATGGCCAACTCAATATCACCATGTGTTAACATGCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCATTT
GCTACTTCTCTTTACATCGGAACTATGGAGGCGAATAACACAGAACCATAACCTAAACAAAACGCTAGGACAAAGCACATTTCAGATGTTTCTGGTAAGG
GCATAAGGCTCCTGTCATGCCGCCTTATTGGTTTGGCTTCAGGGCGGCATTCGGCCCCAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTGGT
GTTGCATCAGAAGGAGAAGCTTGATATGGTGCCTTTGCATGCAGACGATCCTTTCTCTTCTCAAGGAATCGGTGAAGTGACGCCTTTCTAGCAATTGGCA
GATCAGAAGCATTCGGACGAGCAGACTTAGGAGCAACAACCGGATCACTAGGCAAACTACTTGCCGGGGCCAGCACGGCCGTCTGGACCTTGGCGGTGTC
TGCAGCAGTTGTGGTCGCAGAGACGTTCTGAGCAACCGGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTGGCCTTGTCGGCTGGGAAATCGTTGAAC
ACGAGCACCTTCCCACCATAGAAGATGGTCAGCTGGCTCTTGTCTTCCTCCCTAGTAGCGTCAGGGGCGGCGGCGTCCTGCAGGCCGGCGCTCTGCGGGA
AGAGCTCCATGGTCTCCTTCTTCCTGCCGGCCTCCTCGCCCTCCGCCCCAGGCAAAGGGCTCTTGGTGTCCGCCGTCCTGTGAGCCTCGGCCTCACCCTT
GTTGATTCCGAGGCCGAGCTCGGCCGCGGCGGCGCCGTTCTGGCGGACGTAGCGGCTGAGCAGGCTGCAGGCCATGGCGAAGCTGGTCGCCCTCTCCCCC
TGCCTCGCGGAAGCCGCCATCTCCGGTCTCTCTCTCAGCTCCACCTCCGAACCTCCTCCCCTTCCTCCAAACAAACCTTAATAGCGCAGACGGAATCGGA
ATCGGCCGAGCTCGCTCGTGGTGCTAGTCTCGCGGCGGTGGTGGTTGGCTCGCCTTCCTCGTGCTGTCTGTCGTGCGGTGCGGGATGGTAGTGTGCCGTG
TGCGTACGCGTCGTGCGCGTTTATAAGGGAGGACGCGGTTTCTGGCTTGGCAAACTGAAATCTCGCCCCCGCGGTGGAAAACGGA
page-top