Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1914
Contig Information
Length 1248 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsd1e01    whsd6i08    rwhsd1e01    rwhsd18g05    rwhsd6i08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] >gi|445122|prf||1908428A chlorophyll a/b-binding protein
Score 1334
Evalue 4.14228e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1914
AGTACACCGCTTATGCAGACCTTCTGGTAAGCTGATCCTTTGAAGTGCTCTCAAATATCTTGTCTGCGTTGCCCACCTCAAAACCATCGCGCCTGTGGTG
TTCCTTGCCTCGTGCCGAATTCGGCACGAGGATGAAAACCATTTCAGAAATTACTCAAGTAGCAGTGGTCCGATACTCCCATCAGAAATCAGAACGGTCA
TGTTTCTTCTGCCCTTGATAATTTACACGTACGGCACATTCGTACTCTCAAACTTTTCCCGGTAAAATTCACACAGCACATGCTGCTGCATCGCGCGCAC
GCAGCTGATCATCAGCAACCGACGGCGGCGGACGGGCAATAAACGGCCAGCTCACAGGCTGGGCACCCTCTCGGCGGCGCCGGAGATGACGGTGAGCAGG
TTGTTGCCGAAGGGGTCGCTGAGGTGCGCGCACAGGTTCTCGAAGGGGCCCTCGCCGGTGACGTAGGCCTGGATGAAGAAGCCCAGCATGGAGAACATGG
CCAGCCGCCCGTTCTTGATCTCCTTCACCTTGAGCAGCGCCGCCTGGTCGGGGTCGGTGGCGAGGCCGAGCGGGTCGAATGGGCCACCGGGGTGGAGCTT
GTCGTCAAATTCCAGCCCGTTGGTGATCCTGTAGTACTCGGCGCCTCCGACGAGGACGACCTCGGCGACGACGGCGAGGATGAGGTTGATGGGGATGCTG
TTGCCGAAGTAGTTGAGGGTGTTCCCGTCAAGGAGCAGGGCGCCGGTCTTGAACCAAACTGCCTCGGGACCGCAGTTTGCGCCGAACTTGTTGAGCGCCT
CGGGGATGATGAATCCGGCGGCGCCGAGCATGGCCCACCTGGCATGGATGAGCTCAAAGGCCTGGTACTTGGCGAAGTCCTCTGGCTTCTTGCCCAGACC
AAAAGGATCATAGCCGTAGTCTCCGGGAACCTCTCCGTTGAGGTACTCCGGCACCTCCGACCGGTCAAGGAGTCCGTTGGGCAAGTAGATCCTCCTGTCA
GGGCCGTACCACTTGGCGAGCTCGTCGTCGATGCCTACGCTCGAGGTGGCCACGGGGGCGGGCTTCGGCTTCGGGGCAGGCTTCTTCTTGAAGCGATCAA
AGAGGGAGACGATCTTCTGTGCGCCAGCAGTTGGTGCCGCTGTGGCGTACCTGGAGGAGCCGGCGAAGTTGAGCCGGGTGCCGAGCATCTTCGTCGGAGC
GAGCGCCGCCATTGCCTCGAGCCCAAAGTTGAGAGAGAAGGGGCGTGC
page-top