Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1873
Contig Information
Length 336 bp
Tissue Shoot grown with dessication
Clones 5 Clones [Download: CSV  ,  FASTA ]
whsd7k16    whsd7l03    whsd7l04    rwhsd7l03    rwhsd7l04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera] >gi|157338380|emb|CAO39424.1| unnamed protein product [Vitis vinifera]
Score 75
Evalue 5.98415
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1873
GCCCAATTACGTTCTGAGTGAGCCGACAAACCTGATCCGTGATGGCTGAACAAATAAAAACTCGGCGTCGGCATAAAACGGACGCTTGATACAGAAACGA
TGCTCGTCTAGACGTGCACACGTTTGAGGAGAGTAGTACATAAAGCTGGTCCGTGTAAGTTACGTAAAATCGTTGGTTTGTCGCTGGTTCGGGGTCGTGT
TCATATCATATCGGTGGAATGAATCATGGAAGGGTCATTGGCTATCAACAGTCACGCTGCTGGCTATTGCTATTTGCTAGGGCGGTTGTAGTCCTTGAGC
TATCTATCTACTCCTTTCCTCTGTCCAAAAAAAAAA
page-top