Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1803
Contig Information
Length 762 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsd6h08    whsd6j08    rwhsd6h08    rwhsd6j08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase beta subunit [Triticum aestivum]
Score 930
Evalue 1.3029e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1803
GCGGATTACGACGACAAAGAAGGGTTCTATTACATCCGTCCAGGCTATTTATGTGCCTGCTGATGATTTGACGGATCCTGCTCCTGCTACCACCTTTGCC
CATCTTGACGCTACTACTGTGTTGTCACGACAGATTTCTGAGCTGGGCATTTACCCTGCTGTTGATCCCTTGGACTCGACATCAAGAATGCTTTCTCCCC
ACGTTCTGGGTGTGGATCACTACAACACTGCCCGTGGTGTCCAGAAGGTTCTTCAGAACTACAAGAATCTTCAGGATATCATTGCCATTTTGGGTATGGA
TGAGCTCAGTGAAGATGATAAGATGACGGTTGCTCGTGCAAGGAAGATCCAGAAGTTCCTGAGCCAGCCTTTCCATGTTGCCGAAGTTTTCACTGGTGCT
CCAGGGAAGTATGTGGACCTAAAGGAGGGTGTCCAAAGTTTCCAGGGTGTTTTGGACGGCAAGTACGACGACATCTCGGAGCACGCGTTCTACATGGTTG
GAGGCATCGACGAAGTCATCGCCAAGGCAGAGAAGATCGCCAGCGAGAATGCCTGATGACGAGGTGTTACCACCGCTCTGTACAAGTTAAATTTTTTGGG
TTTCAGCTGTTCGCCCGAGACTTGCTCACGAGCAGGAGTGTGCCAGCTCCTGCTGAGGGATCCTTGTTTTTGTTCGTTTTTACTCCAATTTACCCGTAAT
AAGCAACTGCAGTGACATTGGTTTAGTCTGCACAACAGCAACACTACTCTTGGCTTGGAAAA
page-top