Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1756
Contig Information
Length 859 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsd6o01    whsd6o02    rwhsd6o01    rwhsd6o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 2.74063e-53
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1756
TATTCTGTCCTGTCTGCACACACTGAGAGCAATATGGGTGGCAAGGTTCTTCTGATGAGTGCCGTCTTGGTGGGGCTTGTTTCACTGAGCTCGTGCAGGA
GCCTGGGAGAGTTGCATGAGCAGAAGACCCACTATGGGGGCTCACCAACTCCCACGCATGGGTCAGGAGGAGGCTACAACCCGACACTGACACCGACACC
AACTTACGGCACTACACCGACGCCATCTTACGGCACTACACCGACACCAACTTACGGCATTACACCGACGCCAACTTACGGCACTACACCGACGCCATCT
TACGGCACTACACCGACGCCATCTTATGGCACTACACCGAGCACCCCAAGTGCACCTTCCCATGATGTCCCTGCAAGTCCAAAGAAGCATGGGTTCATTG
GATCCTGCGACTACTGGAAGAATCACCCAGATGCTATAGTTGCAGCTATTGGGTCCCTCGGCAACATCGGCAAGACATTTGGTGCTGCATGCAGTATGAT
AGGTGGCAAGAAGCTAGGAAATATGCATGATGCACTCTCAAACACTAGAACTGATGGTATTGGCGCCCTGATACGTGAGGGGGCAGCTGCATACCTCAAC
TCCATTGTGAACAAGAAGTTCCCATTTACCACCCAGCAGGTGAAGGACTGTATCGTCGTGGCCGTGACCTCTGATGGTGCTGCTTCTGCCCAAGCTGGGG
TTTTCAAGAAGGCAAATGAATTCCACTACTAGTTTCAGTCATCGGTGTTTCTTGGCTAAATTTCTTCCTCCCGCGCATTTTTCTTGACTTGATGCCTATC
TTGTGGCTTGATATATTTCTTTTATTTTTGTTGTTTTATCATGTAATATCACTATCTAT
page-top