Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1714
Contig Information
Length 799 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsd10e21    whsd12c15    rwhsd10e21    rwhsd12c15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0160400 [Oryza sativa (japonica cultivar-group)] >gi|113610475|dbj|BAF20853.1| Os07g0160400 [Oryza sativa (japonica cultivar-group)] >gi|218199126|gb|EEC81553.1| hypothetical protein OsI_24977 [Oryza sativa Indica Group]
Score 755
Evalue 2.80794e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1714
TCCTCTCCGCATCCGGCTCCGGAAAGGCCTGCGCTGTGGTCAGAGCGCATCACACTCCCTCTGCTGCCGCGCACCGCCGGATCCGGACTCACATGTCGGT
GGCCACCGGCGGTGAGCAGGCCCTGACGGCCAAGGAGCAGTCCCAGGAACCTGACTATGGAGTTGTTAGTATGCACCATGTTGGAATACTATGTGAAAAT
CTTGAAAGGTCGATGGCATTCTACCAGGACCTCCTTGGTCTTAAGGTGAATCCTGCTAGGCCAAATGACAAGCTTCCGTACAGAGGTGCTTGGCTCTGGG
TTGGTTCTGAGATGATCCACTTGATGGAGCTGCCAAATCCAGATCCACTGACAGGACGCCCAGAGCATGGTGGGCGTGATCGTCATACCTGTATAGCAAT
CAGAGATGTCTTGAAGTTGAAAGAAATCTTTGACAAAGCTGGAATCAGCTACACGCTCAGCAAATCCGGGCGACCAGCGATCTTTGCACGAGACCCGGAT
GGAAACGCGTTGGAATTTACACAAGTGTAACAAGTGAGAGTCAAATTTCCAACTAGAACACACCTCACAGAATGGTGCTTGTAAGATTACTGTATCCAAG
ACCTTGTTGCAGGTCTTGCTGTCTAGCAAACAAGATCTGGCTGGGGCAATTCTGCTTGTGCCTTGTACATACCAGTCAAGAAATTGAGATGTATCTATCA
CATGATGATAAACTGGCATTTAAAATGTTAGCCAATTTGGTCTGTAGTAGTGATTGAGTATTACTGAATGACCATGGGTATGGACAAATAAAAAAAAAA
page-top