Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig397
Contig Information
Length 774 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs9a13    rwhcs9a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_008270 [Oryza sativa (japonica cultivar-group)]
Score 1213
Evalue 2.05736e-131
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig397
CTTTGATAATACTCTGTTGGAGTACCTAGTCAGTGAATACAAAAGATCTGATAATATTGATCTGTCAAAAGACAGACTAGCTCTGCAAAGGTTGCGTGAA
GCAGCTGAGAAGGCAAAAATTGAACTCTCATCAACTGCACAGACTGAGATCAACCTTCCTTTTATCACGGCTGATGCTGCTGGAGCAAAACATTTGAATA
TAACATTGACAAGATCAAAGTTTGAAAGTTTGGTGAATGGTCTCATTGCAAGGACTANAGACCCATGCAAGAATTGTTTGAAGGATGCTGGCATAACCAC
AAAGGAAGTTGATGAGGTCCTTCTTGTTGGTGGTATGACAAGGGTTCCCAAAGTGCAGGAAGTGGTTTCAGAAATCTTCGGCAAGGCCCCAAGCAAAGGA
GTCAACCCAGATGAAGCTGTTGCCATGGGTGCGGCTCTTCAGGGTGGCATTCTCCGTGGAGATGTCAAAGAGCTTCTTCTCCTTGACGTAACCCCCCTTT
CACTTGGTATTGAGACTCTTGGTGGTATCTTCACCAGACTGATAACCAGGAACACTACAATCCCCACAAAGAAAAGCCAGGTGTTCTCAACTGCTGCTGA
CAACCAGACGCAAGTGGGTATCCGTGTCCTGCAAGGTGAGCGTGAGATGGCAACAGACAACAAACTTCTTGGCGAGTTTGATCTTGTGGGCATCCCACCA
GCCCCAAGAGGACTGCCACAGATTGAGGTCACATTTGATATTGATGCCAACGGAATCGTGACGGTCTCTGCAAA
page-top