Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1556
Contig Information
Length 814 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhsd10e06    rwhsd10i14    rwhsd1l20    rwhsd18j05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 483
Evalue 7.38676e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1556
ACTATTCTTGTGTGAGTAACAGCCAATCTCTTCTATTATTTCTTTCAGAGGTTTTTGATGGGCAGTTTATTCCCCCTTCTTAAATTACATACTATTCAAG
CTTAATCAATATTAACTCTTACAGTACCAGCTAAATCATCATTCATGAGTACTTGCAGACTCAACATTGCAGAGCTAAGGCTAATAATAGGACTAAGCAG
GCACATCAGCTGGATACTCTGCAGGATGCTTTTTGATGGTATCCAGCAGCGACCGCTCTTGCTCGCGAAGGTTGGAAGGCATTTGATCATACACATCAGT
GAAGAGCTCCGCAAGCCCGTGTTTTGGCATCCTCTCGGCCACCTGAATGGCTTGCAGGAGCTCTTGCCGCACATTGTTCCTGAGTTCAGACTCTTGAGTG
TCGCACCACCATCCATTCCCCTGAACCCATTTTCTGTACCTGGAGACGGGATCCCTCGCTGTTCGCCAATGCTCCATCTCATCGGGCCGGCCTGTACTTG
GTTGAATCGTCGGATGTCGAGTGATGGCCGACTCGGTAGGTCATCGCCTCGATTAAAATAGGCCTTCCTTCAGTTATAGCCATTTCCCGGGCGGTGTGGA
CTGCACTGTACACAGCAAGAGTATCGTTGCCGTCTACCCTGATACTGCGTATTCCGTAGGCCTGACCGCGGGTGACAACTCCATCACTTCTGAACTGTTC
CGCGGTTGGGGTGCTGATTGCCCAGCCATTGTTGCGGCAGAAGAAGATCACTGGCGCTTCCGTGACAGCAGCGAAGTTGAGCGCGGCATGGAAGTCTCCC
TCGCTCGTGCCACC
page-top