Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1514
Contig Information
Length 689 bp
Tissue Shoot grown with dessication
Clones 4 Clones [Download: CSV  ,  FASTA ]
whsd10g20    whsd15o02    rwhsd10g20    rwhsd15o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Nematostella vectensis] >gi|156210942|gb|EDO32082.1| predicted protein [Nematostella vectensis]
Score 95
Evalue 0.0717163
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1514
TTTTTTTTTTAGCAGAGTTAAGATGAGATAATGCTAATAGTAGATACATGCCATTGCCATTGGTTCAAGGGCGCCTCTAAAGTTATAATACTAAGACCAC
ACACACAGATAGGTTGATGACTAATCCTCCGGATCAATCAACTACTAGTGTAGATAGATAGCATTGGTAAACCTCTTCATCCCAGTCAGTCAAATTACAA
GAGGAACAATCTCACGCCCGAACAAGCCCATCAACACCATGGGAACCCTCCTCCTCCAGCTTGCAGAACAAGTAGGCATATTCAGCCCTGAGCTTCTCGA
TCTTGTTGCAGTCATCGTCCTCCACCTCCTCCGGCTGGAGGCGCATGTAGGCGTATTCCTCAGTGCTGTAGTCCTTGTACTTCATCCCTGGATGGTCAGC
CCTGAGCTTGTCGGCATGGGCGTTGTAGTCTGCGATGAGCCTGACCATGAACTCCTCCTCTTCGTCCGAGTCGCAGTCATCCTCCTCCTCCTCCTCCTCC
TCCTCCGCCTTGGCCTTCACGGTGAACACCGCCTCCTCCTCNGANTTAGCCTTCAAGGTGAACGCCGCCTCCTCCTCCGACTTGGCCTTGAAGGTGAACG
CCGCCTCCTCCTCTGACTTGGCCTTGAAGGTGAACGCCGCGTCCTCCTCACGGTCCTCCTCCGCCTTCCTCTTAGAGCCACACCCCGCC
page-top