Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1494
Contig Information
Length 791 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
rwhsd11g09    rwhsd17f04    rwhsd17f15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calnexin precursor [Zea mays]
Score 603
Evalue 1.16739e-60
Total Hit Count 484
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1494
GATCCTTTCAGGTTTCGTTTGATACAAAAGGAAAAGGAGATCACTTCTAGCTGATTCCGGACAGCACACAAACAACACAAGGCTTCACCGGCTCGTAGGT
TCTAGCGCCTTAAAACTAGGGGTAGCAGCAGAGGGCAGCAAGACTGTTCGATTATACACTCGAGGAGTTCACAAAAAGGCCAGGACCGAGACGTCCGAAA
TGTGAAGATCCTATGTCTCCCTTCGCGACCTTCTGCGTGGCACCGTCGTGTCATCCTCTTTCTCCTCCTTGTCGCCGCTGCTTCCAGCGGCATCGGCTTC
CGTGGCACTGGGCTTCTTGACCTCGGCAACGGGCTTCACAGGTGCCACTGGCTTCTTGCCACCGAAAATGGTTCTGAAGAGTACAGTCACAAGGATGACA
GCGACTGAGGCCAAGATCGAAATTGTAATGTTGGGCTGCTTCTCTCCCTTCTCAATAATATCAATGATCTTTATCTTGTAAGGTTCCAAGAATGGAATGT
CGGCGATTTTGTACAAAACACTGAAGATCTTCTTCTGGAACTCAGAAAGGTCTTCTGAATCGGCTGCTGCAGCCTCCTCAGCCTTCTGCTTTTCCTTCTC
AACATCAAACTTGGGTTTCCATGTCTTCTCCAAGATGGCGGTGGCTACCTTCTCATCATCGGCGATAAGAATGTTGTCAAAAAGGATGCCATCCTGCATT
GTCCAGATCTCAATTCCAATAGCGGCAATCGGATCAAAGTCAGGCTTGTCAAGCTCAAAGTATTCAGGGTTGGGGATTTCTTGGGGCTTCC
page-top