Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1363
Contig Information
Length 667 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsd10b04    whsd10o01    whsd10o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L3-B2 [Triticum aestivum] >gi|118152404|gb|ABK63946.1| ribosomal protein L3-B2 [Triticum aestivum] >gi|146141394|tpg|DAA01145.1| TPA_inf: ribosomal protein L3B-2 [Triticum aestivum]
Score 1057
Evalue 1.85673e-113
Total Hit Count 407
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1363
CACCTCTACAGGGGAAGGAAGGGAAGATGTCGCACCGTAAGTTCGAGCACCCGAGGCACGGATCCCTCGGTTTCCTCCCCAGGAAGCGGTGCTCGCGCCA
CCGCGGAAAGGTGAAGGCCTTCCCCAGAGATGACCAATCCAAGAAATGCCACCTCACTGCCTTCCTTGGCTACAAATCTGGGATGACTCACATTGTGCGT
GAGGTCGAGAAGCCTGGTTCCAAGCTGCACAAGAAGGAGACATGTGAGGCTGTCACCATTGTTGAGACACCCCCGATTGTTATTGTTGGACTTGTTGCCT
ATGTGAAGACTCCTCGTGGCCTTCGTACTCTCAACTCAGTCTGGGCACAGCATCTCAGCGAAGATGTCAGGAGGAGGTTCTACAAGAACTGGTGCAAGAG
CAAGAAGAAGGCCTTCACCAAGTATGCTCTGAAGTATGACAGTGATGCTGGCAAAAAAGAAATCCATATGCAGCTTGAGAAGATGAAGAAGTATGCTACT
GTTGTCCGTGTTATCGCCCATACCCAGATCAGGAAGATGAAGGGATTGAAGCAGAAGAAGGCTCACCTCATGGAGATCCAGATCAATGGTGGCACCATCG
CCGATAAGGTTGACTATGGTTACAGCTTCTTTGAGAAGGAAGTCCCTATTGATGCTGTGTTTCAAAA
page-top