Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1355
Contig Information
Length 757 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsd10c05    whsd10c06    rwhsd10c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_028127 [Oryza sativa (japonica cultivar-group)]
Score 736
Evalue 4.04476e-76
Total Hit Count 482
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1355
AGATGCAGAATGGGAGACATGCGGCCTGTCAACAGACTTCAGCTGGAAGCAAATCGCGGAGCCGGTGATGAAGACCTACACCGAGACAACGGACGGGTCG
ATCATCGAGGACAAGGAGACAGCAATCGTGTGGTGCTACGAGGACGCGGACCATGATTTTGGATCTTGCCAGGCCAAGGAGCTCCATGATCACCTGGAGA
GTGTCCTCTCCAACGAGCCGGTATCAGTCAAAGCTGACCTGCACTATGTTGAGGTGAAGCCACAGGGTGTGAGCAAGGGCCTGGTGGCGAAGCGGATGCT
GTCGACAATGCAGGAGCTGGGGCTCCAGCCCGACTTCATCCTCTGCGTCGGGGACGACCGCTCCGACGAGGACATGTTCGAGGTGATCACCACCGCGGTG
GACGGCCCCTACCTGAGCCCTTCCGCGACGGTCTTCGCCTGCACCATCGGCCAAAAGCCCAGCAAGGCCAAGTACTACCTGGATGAGCCCGCCGACATCA
AGCGCATGATCCGGGCCCTCGCGAGCGTCTCTGACCAGGAGCTGGCGATGGAGGAGGGCGAAGACCCTCCTTACCCTTTCCTCGCCGGCGACGGCACCAG
CAGCGACGACACCTGGCTGGACTGAGGGGGGAAGCCGGCAGAGANGACCAGCAGCAGCGCAGCCTCCGGCCTGAATAAGACAGCATAATGGACGTAAACG
GCACCATAGTTGTGTTTCTGCTTGGTTGTTGTTCTGCTNNTTTCGCCCGTTGTGTAT
page-top