Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1340
Contig Information
Length 791 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsd10g19    rwhsd10g19    rwhsd20k13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine/threonine-protein kinase 38 [Zea mays]
Score 389
Evalue 7.6196e-36
Total Hit Count 61
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1340
TTTTTTTTTTACAGTAAACAAAAATTTAGGGCATTTCTGCAACGGGAGACCATTGACCAAGGGCCATGTCTCTGAATGGAAATCTTCTGGTACATATGTA
TCAAACACCACCAACAACAATAGCTTAGCCTGCCTCAGTTACCACCTTATTTCGCTTCCATGATCAAATGTTAGCGGACCAGGAACTGCCACAAGAGAAG
GCAGCAATTTGCTCTGCCAACCTGGGCAGCCAGCCCTCCCAAACATGCCCATCTCCACTTGGTCGGAACACGCTACACCAAACACGACGAGCCCACCGGT
GGATGGACCATTTGTCTAGTCCTTAGCATACTATTTTACAGCTAGAAGCTTTCTTGGATTTCTACAAACTGCTCGCCAACGATTTAATAGGGCAGAAACC
TGGCTAAAAACAAGCAGGTTGTCCAGACGAAGCCACTTCATTCAGTCGTTTGCATGCTAATTTAGTTTAGAAAAATCTCAGCAACAAACAGAACCACGCC
GGGTTATGGACTCATCGGATCCCCGGAAGAAAAGGTGTGCATGTGTGTGTCCTTTCCATTTGGTTCTCTCGATGACTCCATGCCATTTGATCCGAATATA
GCACCAATAGAGGGCCTTGTAAGCGATGAGCTCCTTTGCATATCTGCATGTTTTAATCCTTTCACAGCATCAAAGTTTTTGTATGTATACCCCACAAAGC
TGAGATCTTTTGAATTCAGCTTCGCCTTTCTTGATGGCCCAGAACCTGTTCTTGCTGGAGGGCTATTATCCATCTCATCAAACTTCATGAA
page-top