Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1325
Contig Information
Length 802 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsd10f11    rwhsd10f11    rwhsd16e03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit class I alpha-mannosidase 1A [Aspergillus clavatus NRRL 1] >gi|119396433|gb|EAW06865.1| class I alpha-mannosidase 1A [Aspergillus clavatus NRRL 1]
Score 81
Evalue 4.0212
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1325
TTTTTTTTTTGGACGAAAACAAATTTTATTTATCCCAGGATGATTGCAAGGTTACAGCACTCGACCACACGCCTGCAAAAACCGGGGATCTGGAGACAAA
AAACAACCACACAAGGTTGTCATGGCAAGGGTCCGGGGATATGTTGCACCTTGCCAAGGCCAGATCCCCGGGGATATCAGGCAACCCCTGCAGATGCTGC
AGAAAAGCGACCATCCACCGCCGACGACACACACGCACAGCACACACACACACACACGCTACAGACCGTGAACAGACTGAAACTGGAACAACCACACACT
GAAAGAGATCGTAGCAGACACCTAGACACGGATCGAAGAACCGGAACCAAGCTTCTACGACAGGCACGCACCCCGACAAATCCGACAAATAGAACTTGCT
ATGGAATTGAAACCAGAAGTACTGATGTCCCACAAACTCTGGAACCAGATTGTACTGGAAAAGAAGACACAACTGACTGACAATATTTGAGCTCCCACAC
AGGACTTGATAAGGAGAGAAAAAAAGAAGCATGGTGTAGGGACTGTAATCACAAGGGCATAGGTTGGGGGTAGAGGGACAGGGTGCCACGCTAATGGCAG
CCGAAGGCTCAAGGAACAGGCATCCTCGCGAGAGGAGGNCTGCAAAAAACGAGCGCTTGGCTAAAGCGTCCCCCGGAAAACAACCGACCCTAAGACAAAG
GAAGCCCACCATGACTCAAACGCGCAACCGACGAACCGAACCGACTCTGCTATGAGGCTTGACTGAANAAGTACTACCTACGGTCGTATATTTGCATCTG
GA
page-top