Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1291
Contig Information
Length 1101 bp
Tissue Shoot grown with dessication
Clones 3 Clones [Download: CSV  ,  FASTA ]
whsd10m12    rwhsd10a01    rwhsd10m12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1134
Evalue 9.25746e-123
Total Hit Count 123
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1291
ATGTACAGCGGCAATGGTACAGAATATTTACATTGCGGCGTGGCGCACATGAGCAGCCGCGCTTTCGCGTGAACTATGCACCTCTCAGATGCAGCTTCAA
CATGATCACTTCCATGAGAACTAACTATGCACCTCTGAGTTCATGTGATTATGTGGACCACTCATTGCTCCTTTTGTGCCTCTGGGAACAACTGCAGCGC
TTGCGTCGTTAGTCGCTTCGCGACAAAGAACAAGGGTATTCTATTCAGTTTCCCTCCATGCAAAGATTTCAGTTCATCAATGGTTTGCTCTTCTTGTGTA
CCAGCAGCTGTCATGACAAACAGTGGGTATAGTATTGCCATCACACCATAACTTGTAAGAGGAGAGAAGAAGAAAATCGGAAGTACACATGGACTACCAA
ATCCGGCAAAGAAAGCCCAATTTGACTCAAAGAAATCAAGCCGGTGGTTCAGGCTCACTGCAAAGAAGTTCCACTTGTACTCGAAGCAGTAGTAGGCATA
CATCAAAGACAGTAACATGAAGTTCATTGCCTTACCAAGGTAAGGTATGCAACCAATCACTGTAACCTCAGCAAAGAAAATAGTCAAAAGAAGTATCGAA
TAGACCTGCTCTCCAACACCAATCGCAACCCCATCAAATCCTTCAGGCCTATCTGCTGATACAGATGTGCTGTGAGGGTCAGAGTCAGATGCTTGACTTG
CATCCAGCTTCTTACTTTTCACAACAGCCAAAGCATGCTTAGCAATGTCACCATACCAAAGTGTACTTATTATAAAGCTGAAGATGTAGAGGGGATAAAA
CCAAAATNCATAGAAAATCTCGACAAGCCCCGAACGTAAGAACGAATACAAGGCAACAGCTGTTGTGTGATCACATAGATGTTGTCCCCATGATTGATCG
CATTGCTCGGGCAGTATCCATAGAAGAGTTGGAATGNCCACCGATTTCAAGGTTAGCAAGCTCCCCAGGAAGATGAACCCGTTGAGCAGGAAGCACTGAG
CGATTNTGATCGACAGAGCCCTGGAGNTGACGCAGAAGGAGACGACCGCGGTGGAGACGCGCGGCCTGGAGGAAGCCGGCGAGCCAGAGCACGGCAGCCG
G
page-top