Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1141
Contig Information
Length 758 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10a09    whsd17m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proliferation-associated protein 2G4 [Zea mays]
Score 933
Evalue 5.80013e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1141
AGCCCCAAACCCCTCGCCCTCCCAAACCCTAACCCTAAAACCTCCGCCCTCCCGCCGCCGCCGCCGCCCGATTCCCCTCCCCAGGCCCCGCATCCCCCGT
CCGGCTTGAACGATGTCGTCCGACGAGGAGGTCAGGGAGGAGAAGGAGCTCGACCTCTCCTCCAACGAGGTCGTCACCAAGTACAAGACCGCCGCCGAGA
TCATCAACAAGGCTCTGAAGTTGGTATTGTCGGAGTGCAAGCCGAAAGCCAAGATTGTTGACATTTGTGAGAAGGGTGACAATTTCATAACAGAGCAAAC
TGGGAATGTCTACAAGAACGTGAAGAGGAAGATTGAAAGGGGCATTGCTTTCCCGACATGTGTATCTGTGAACAACACAGTCTGTCATTTCTCCCCACTG
GCAACTGACGATTCTGTACTCGAAGAAAATGACATGGTGAAGATCGATATGGCTTGCCATATTGATGGTTTTATTGCTGTGGTGGCTCATACACATGTCA
TCAAAGGTGGGCCGGTTACTGGAAGAGCAGCTAATGTTCTTGCTGCTGCAAACACAGCAGCAGAAGTTGCAATGAGGCTTGTTAGACCTGGCAAGAAGAA
TAAGGATGTCACTGAAGCAATTCAGAAAGTTGCTGCTGCTTATGATTGTAAAATTGTTGAAGGAGTTCTTAGCCATCAGCTGAAACAATTCGTCATCGAT
GGTAACAAAGTGGTACTTAGTGTTTCAAACGCTGATACAAAGGTGGATGATGCTGAAT
page-top