Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig349
Contig Information
Length 808 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10d08    rwhcs10d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DAG protein [Zea mays]
Score 477
Evalue 4.92001e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig349
GCCACCACAAGGAAACTTCCAAGGGTCCCGCCCACAGCAAGACGTAAGAGGCTACGCTCCACAGCAGAATTACGCACAAGCTGGGCAAGATGGTAGAGGT
TATGGGAGGAATGATTCTGCCGACCATCCAGGTTACAATGCGCCTGGTGGGTACCAAGGGCGTGTAAATGAAGCCGGTCAAGGTTTCCAAGATCCACAAG
AGCGCAGGAGTTTCTCGCAAGGACAGGAAGGAGATCTCAGGCCTGGTGGCCCTTCAGCACCTGGAAATTATGGTCAACCGCCTGCACCTGGAAATTATGG
TCAACCACCTGCACCTGGAAATTACGGTCAACCGCCTGCACCTGGAAATTATGGTCAACCACCTGCTCCTGGATCCTATGGGAAGCCATCTGGACCTCCA
GCTTATGGACAACCGTCTGGGTCGAGATATCCTGGAGGTAACCAAGGGGGTCCTGGTTATGGTGGAGACAACAGACAGGGTGCAGCGCCTGCATATGGAG
GGGATAACTTGCAAGGGGTTTCTGGTCAGTATCCTAGCCCAGGTGAAGGACAACAAGGGAACTGGCAGGGTAGGCAGTAAGGACCTGATGAGAAGTAGCT
TCACTTAAGAACAAGGCATTAGTTCCTCTACTTGAAATGTAGAAATTTCCACCTGTAAAATAAACAGCTGAACTACTTTATTTTGTCTTGTTGCCTGCAT
TCACATCAGACTTATTATTGATGTGCGTTACTATCTCTTGTAGCCATATATTTGACGTTTGGAAAGGCTTGTGGAGTCTGGAGTGGTCTGTGCTTTTGAA
AAAAAAAA
page-top