Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1115
Contig Information
Length 768 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsd10c15    rwhsd14j14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine hydroxymethyltransferase [Triticum monococcum]
Score 809
Evalue 1.42162e-84
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1115
AATGCGTGGTAAGTAAATGTTTATCCAAGAAGGATGGCGGTTCATATAGCATATCAGCGAAGCATCTTACAGTATGTGCCTGCAATAAGAAACTATCGAC
AAAGTTCCCATATTCTGTAAAATGATTGGATTCCTTTTACATAAGGTGGCGCTTCATCGTGGATCTATTGTTTACATGACTTGTCCTCAAACTGTGCTTC
TTGTTTGCTTCCTTGCTGTTGAAACATAGCAGTTCTTAGTTCTTGTACTTCATGGTCTCCTTCTCGAATCCAATTGTTGGGAATTGTTTCGCATATTCCT
CCACATCGTGGCGAAGCTTTGCAATTTCAGCTTGGATGTTGCTGTCGGATTGCAATGTGGCAACAAAGTCCTTCAGTTTGGTACCTGCTGCTGCAGCTTT
AACCTTCAAGGCCAAGTTCACTGCCGAATCGAAGAAGTCAGCAACCTTGGCGAAGTCCTCCTCAACAAATCCTCTTGATGTAAGTGCGGGGGTTCCCATC
CTGATGCCTCCGGGTACCATAGCTGAAACATCACCAGGAACCGTGTTCTTGTTTGCTGCAATATGCACATTTTCTAAAACCTTCTCCACACGTGAACCAT
CTATTCCCTTTTTCTTGAGGTTCACCAAAACTAAATGGTTATCAGTCCCACCAGAGACAATGTCGTAACCTTTTGAAGTCAAGCTCTCAGCAAATCTAGC
AGAGTTACTCATAACTTGCTCTTGATAAGCTCTGTACTCCTGAGTAGTTGCCTGCTTAAGCGCAACGG
page-top