Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig1103
Contig Information
Length 818 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhsd10a09    rwhsd17m09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit proliferation-associated protein 2G4 [Zea mays]
Score 883
Evalue 4.19809e-93
Total Hit Count 374
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig1103
CATTCAGCACACCATACATAATTATCAGGCTTGTACTTCGATGTGATGTGCGCCAGGATCAACCATTTTCATTAGACACTTCAAAAAAAGGTACTCAAAT
CCCCACAGCTGAATGTAATATAAAACAATCAGATGCAGCAAAGGAGCAGGTACAAACGTAACGGAAGCAATTCAAAAAAAAAATGAGAATTATTCCTGGC
TTGGTGCGTCCTTAGAAACCTCCATGGGCTCTGCTGCTTCTGCTGCATCTCCTTTCTTGCCTTTCTTTTTCTTGCCACCACCCTTCTTCTTTGACTTTGT
GCCCAAAGCAAGCCAAGCCTTGATCTCCACGTCGTCCTCGATGGATTTTGAGGGCTCCAGTTGCTGTAGTGGATGTGACGTTATCTTGTCAGACCCATTT
GGCATCAACAACACGGNGAATTTGATGTGGGCAACCAGGTCACCTTGCTTCTGGTGTAAAACAGGGTATGGCTGCAACAGCTCATGATTCATGCATTCTA
CCAAACCTAAGCGTGCACGCTTCTCCTCCAGCGCCCTAGCAGTGAATGGCATGATTGGGAACTTCTGGCTAATCTCACTGAAGATGAACCTTGATGCCTT
CATCTTCAAGTGATAGTTCTTGTCTACAGCTCTCTTGTAAATAGTGGTCTGCTTCTCATCCAATAGCTTCGGCTTTCCCTCGCCAGTGCTGGTGACAATA
TCAATTGCATACACTTCATTTTCTTCAAATTCAGCATCATCCACCTTTGTATCAGCGTTTGAAACACTAAGTACCACTTTGTTACCATCGATGACGAATT
GTTTCAGCTGATGGCTAA
page-top