Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig345
Contig Information
Length 804 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10d09    rwhcs10d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02229 [Oryza sativa Indica Group]
Score 121
Evalue 2.34351e-05
Total Hit Count 44
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig345
GGCAGAGGCATCCCCTTTCTCTCCCGGGCGACGCGACGGCGACGGCCGATTGCTGGCGGCAGAGAGGATGTTCCCCAAGATCAGCGGCAGCGTGACATGG
CGAGGGTCAGCGCGCTCAGTCGTACGCGGGCGGCGCTCACGAGCTCTTGGTCTCCGGCGGCTGCGGCGCGAGATCTTTGGTCTCCCGCGACGGCGGCGCG
AGCTATTGGTCGTCGGCTGCGGCGGCGCGAACTCTTGGCCGGATTGTGCCACGGCGAGGTCCTCCATTGTTGTCATGTCGAGCAACTAAAATCGCAAATA
TCCTGCATGTTGTGTGAAATTGCCCATGTCCCTTGGTTGTCTGATGATGTTACTTTTTGCTTGACAGATTCAGAGTTGTGTTAGATGTGTGATGAAACAG
TACCACACAAGATGCAGATTCTGATAACAGAAGCTAAACAAGCCAATATATTGTTCAATCTTGCATCATCAACACTATTATATGGTTGCCTGTGTATATC
TTGTCAGGACATGTCATCTCTGCAAACAAGTGCAGACTCAATCCTTCTCTGAACATACCATCAGCTAGTGCCCTCCCTGTGAACATTTTCAGGATCCAGC
AGCTGATGCAGAAAGGGCACAAAATCAAGGCAGTTCAGTAAGAAATATGTCTGTTGGAAACATCCCTATATATTGTTGTTGTTCCGTGATGTTGTACATT
GTAAACATATCTCCCTATTCAGGGATTTAGTTAGCCACGACTGACTAGCACGTTCGTGCACTCATGTACTTGGCTGAGATCAATACAAAAGTGGGTTTCA
TCAA
page-top