Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig998
Contig Information
Length 906 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10a24    rwhsd10a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0153000 [Oryza sativa (japonica cultivar-group)] >gi|113578227|dbj|BAF16590.1| Os05g0153000 [Oryza sativa (japonica cultivar-group)]
Score 486
Evalue 5.43842e-47
Total Hit Count 342
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig998
TGATCTGGCAACGGAGGAGACCTTGATACTGGACTGCGGCGAAGAAATCTACGTCTGGGTTGGACTTCACTCAGGTGTCACGTCCAAGGAGCACGCCCTC
GACTTCGGCAAGATGTTCCTTCAGGCAGGCATTGCTCGGGATGGACCACGGTCGGTCACTGAGACAACCGTGTATGCTGTCGCGGAAGGGGATGAACCTG
CATTTTTCACCAGCTTCTTCAATTGGGATAGCTCAAAACAAGCTGCAGCTATGCTGGGCAACTCATTTGAGAGGAAGCTGGCAATGCTGAAAGGGCTTTC
ACCAAAATTGGAGTCACCGGACAGGAGCTTGCGCAAGTCTTCGTCGCGAAGACAGGGGATGTCGTCAGAGCCGACGACGCCGGAGCAGCAGCAGCAGCAG
CAGCCGGCGGCGAGGAGGACGTTCGGTTCTGCCTCTGCCGGGAGGACCGCTAGGGAGAGACTGCCACCATCTTCATCCGCAGCGTCGCCGTCGCCGGCAA
CACCTTCCTGGTCTCTCAAGAGCCGAGGGTCGTCGTCGCCGTCGATGCCAGCCACGGCACGGCGGCTTTTCCCTTCCTCGCTGCACGCACCGGGGACAGC
GGCCGCACATCTCCCCTCCCCTACGGCCATAGGGAGTCCTGGTCGACGACGGTGAGCAGAGCTCCCCGGTGCACACCGGAGGAGGATAAGTGATACCTGT
ACCTGTACCGTAACATACGCCCGATATTTGCTTGCCCTAGGGGATGAACTGCAGTCAAAGTCCTCCATCACAGAACGTGATTTCGCCTCGTCCTTGGCTA
ATCACAACGAAAATATCATAAGATTGCCCATAGTGGGAGTAATGGTAGTAAAGTTTATTAGTCCACTTTGTATTTTGTGTAAAATTTTGACCTTAATTTT
TTAAAG
page-top