Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig983
Contig Information
Length 498 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd20b14    rwhsd20b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 431
Evalue 3.41823e-41
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig983
GGCTCTACTGGCTACGACAACGCCGTGGCGCTACCCGCCGGAGGCAGAGGAGACGAGGAGGAGTTGGCCAAGGAGAACGTGAAGAACGCGTCCTCCTCCA
CGGGCAACATCACGCTCAGCGTCACCAAGAGCAAGCCGGAGACCGGCGAGGTGATCGGCGTCTTCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGC
CAAGGCGCCCAAGGATGTCAAGATCCAGGGTGTGTGGTACGCGCAGCTCGAGTCTAACTAGAGCAGAGCAGAAGTGAAGATACTCATCTTGTGTGCATGC
GTACGTGGGTTGATCGGTGGAGAGGAAACAATCGAGGCAACAATGTGTGTTTGTGTGTGTATCTAGTAATCTAAACCCAGGGTGTCGGTTTATATTTTAG
CTTCTGTTATTGTTTCTTCCTCGCCTACTCATGATATTGATCCCCCATGAATGTTCACAAAATTGTCTGTGGACACTTTCTTCGTTTTAAAAAAAAAA
page-top