Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig943
Contig Information
Length 750 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd3l08    rwhsd3l08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0595400 [Oryza sativa (japonica cultivar-group)] >gi|20521311|dbj|BAB91825.1| unknown protein [Oryza sativa Japonica Group] >gi|20804631|dbj|BAB92321.1| unknown protein [Oryza sativa Japonica Group] >gi|113533000|dbj|BAF05383.1| Os01g0595400 [Oryza sativa (japonica cultivar-group)] >gi|125526673|gb|EAY74787.1| hypothetical protein OsI_02682 [Oryza sativa Indica Group] >gi|215697391|dbj|BAG91385.1| unnamed protein product [Oryza sativa Japonica Group]
Score 515
Evalue 1.68271e-50
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig943
TACGACGAGCTCCGCCTCCGCGGCTTCCCGCGCGGCCTGCTCCCGGCCAACGTTCGCGGGTACACGCTCGACGCCGGCTCGGGGGACTTCGCCGTCGACC
TCGACTCCAGCTGCCGCATCGTGCTGCCGGCGGGGAGCTACCTCGCCAACTTCAACGACCACCTCACCGGCCACCTCGACGACCGTCGCATCTCCGGCCT
CAGCGGCATCCGCGTCAGGGCTTTCTTCCGCTGGTGGTCCATCACCGGGATCCGCGCCGATGGAGACGAGCTCGTCTTCGAGGTGGGCTCCGTCTCCGCC
AAGTTCCCCGCCCGCCACTTCAACGCCAGCCTCGAATGCCCCGCCAAGGCCGACTCTTAGTACTATAACAAGGAACTGTTGCGTGCCTCATGACACTGGC
ATACCATCAAGTCGCCTTGACGTCGAGCACTATGATTGTTTTTAATCTCTCACTGCCTTTGTAATTACTACTTGTGTATAAGGCTGGATCCCTAAGCCAC
CACTCCACTTTCGACACCAAGAAAGCGGGATAATGTAAAGGTTCTTCTTTGCTCTTTTGTTGGATGGCTTGTCGTAATAATCCTGGGAACTGGTAATGGT
TTTTATTTCAGTTTGTAATCTACAACTTCTGGTGTGGCGAGTATACTATACCTAACTAGAGAGAGAATCGAGAGATGTAAATGAATCATGTGTATGTCTT
AACCCACTTATATTGTTCAACACGGGTGGGAGTCGAACTCAAAAAAAAAA
page-top