Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig859
Contig Information
Length 387 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10b19    rwhsd10b19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit FolC bifunctional protein [Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774] >gi|219869302|gb|ACL49637.1| FolC bifunctional protein [Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774]
Score 87
Evalue 0.24354
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig859
CCGGATTAGTAGTGATTGAGCCAGCGGATGTGCTGGTAGCAACACATCATTCCGCCTTTGGGTTTGTCAGTTCGGTACCCAATAGATATATGTTTTTTCT
CTAGCCATTGCTATTCTTTTTAGTGTTGCGCCCAACGAAAGCATTGGCGTGGTGCCAAATTTTTGCCATGTGCCCTCTTGTACAGTATATCACTGCCCAA
TCATTTCGACTTAAAATGAAACCGGTGATGGGTATAGATTTTTGTTTTAAACCCATGGAAGATGCTATGGGAACCTTTAGTTTTAGTGCCAAGTACTTGT
ATCTAAACCACCGGTTGGTTTTGCCGTGATAAGTCTGACATGGTTCGTGTTAAGATGCGAAGAGGTTGTGCTACATGAAAAAAAAAA
page-top