Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig809
Contig Information
Length 511 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10g17    rwhsd10g17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01672 [Oryza sativa Indica Group]
Score 221
Evalue 8.17861e-17
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig809
CGACGGCAACCTCAACGTGCTGGTGAACCGCTTCGCGGGGAACGAGACCCTGTGGAAGGAGCGCTTCGCGGCCGCCATGGTCAAGATGGGCCGCATCCAG
GTGCAGACCGGCAACTGCGGCCAGGTACGGCTCAACTGCAACGTCGTCAACCCGACGTCGTCGTCGGTCAGCCTGGCGGGCTCAGTCGAAGAGGACGGCC
TCGTCGCCACAAGCTAGCCGAGACTCACGCACACACTTGGAGCACCGATCGAGTCAGCATGGTGTTCGCCCGCTTTTTCCTCGGACTTGCTAATAATCAT
TTTTTTTACTCATTGTCTCCTATGTCATGCATGTGTGCGGTTTTGTTTTGTTTTGTTACGGACTACTTGCCGCATGTGCCAAGTTTGTTTTCTCGCCCTG
AATTCAAGCATGAATTGGTAGCCAGCGGTGTTCCTCAGCTGTTTGGCTAATGGAATAAATATGGTTACATCTCAAAAAAAAAAAACGTTTGTTTTGTCGC
CAAAAAAAAAA
page-top