Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig645
Contig Information
Length 846 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10g15    rwhsd10g15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14197 [Oryza sativa Indica Group]
Score 952
Evalue 4.45955e-101
Total Hit Count 194
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig645
ATTTGATGGATTTGTTGATGCTGGGTTGCAGTCTCCCAAAGATGTGGTATTGTCAGAAAATTTGCTACACTCTGCTGTGCGAGGAAAATCTGCCCGAATG
GTTAGATTTCTGCTGACATACAAGCCGAACAAAAACCTGAAGGAAACTGCAGAGACATACCTATTCAGACCTGATGCTCAGGGCCCTTCTGCATTTACGC
CCCTCCATATAGCAGCCGCTACTAGTGATGCAGAGGATGTATTGGATGCATTGACTGATGACCCTGGACTGGTGGGACTCAATGCATGGAGAAATGCGAG
AGACGAGATAGGCTTTACCCCTGAAGATTACGCTCGCCAAAGTGGCAACGATGCTTACATCAATCTTGTCCAGAAGAAGATTGACAAGCATCTTGGCAAA
GGTCATGTTGTCCTCGGCGTTCCTAGCAGCATGTGCCCTGGAATAACCGATGGGATGAAGGCAGGTGATATCAGCCTTGAGATCTGCAAAGCCATGCCAA
TGACAACAACATCCGCCGCAAGGTGCAACATCTGCAGTTGTCAGGGTAAGATGTACCCCAATTCCTTAGCCAGGACCTTCCTGTACAGGCCAGCAATGTT
CACTGTGATGGGTGTCGCCGTGATCTGCGTTTGCGTCGGAATACTCCTCCATACCCTCCCCAAGGTTTATGCTGCACCGAATTTCAGATGGGAGCTGTTA
GAGCGCGGAGCCATGTGAGGGGTCCGGGCCAGAATAAGGTTAGGTGTGTTACTGTTGAGAGTTTTAGTGTGGTGGTTAGATCAAACAAACATGTAATTGT
GTGAAAAAGTTCCGTTGTATTAAAAAATTGCAGAATCTTTGCGCTG
page-top