Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig291
Contig Information
Length 688 bp
Tissue Callus
Clones 2 Clones [Download: CSV  ,  FASTA ]
whcs10d17    rwhcs10d17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002382 [Oryza sativa (japonica cultivar-group)]
Score 321
Evalue 4.41582e-28
Total Hit Count 85
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig291
CAAAAGTGGCCCCAAATGCTGTGGTTCCAAGTGTCAAGGTGCTAGCTTTGAAGGTGGATTTCGGAGTGGCCGAGGAAGTGAAGACCCTGCTCAGTTTCCG
GAGATGCTTCCCCCAAGTCGAGACCCTACACGTCATGTCCTCCAACAAGAAGGAAGAGGAAGAGGACGAGCAGGACGAGAAAGACGCGGGTGATGCCAGT
GGCGAGCAGCTCATCATCCCCACGTTCTGGGAGGAGGCCGGCCCGATCGGGTGCGTGGAGTCGCAAGTGAAGAAGGTGGTGCTGAACCAGTTCACCGTGG
GCGCCAACGAGCTGGGATTCCTTAAGTTCGTGATCGCGAGGGCTCAGGTGCTGAAGAGGGTGGTGCTGGTGCTGGACCCCGGGATGAGCCCCACGGCGGC
CAAGGAGGCATTGAGCAAGCTGGCGACGCAGCTGCCTTCCGCGAAGTGTGTCAATGAGAACGTGGAGTTCATGGGGCTCCCGCGCCCAATGGCTCCCTGG
AGCTACCAGATCGCGTCTGATCTCTCCCTGAGCGACCCGTTTCCGGCTGAAGGCGGTATACTGATGCAGCGTCCGTGAGCGTCGAACACTTTGGATGTTT
CTCTCAAGAACTTATTAGGAGTAGCTAGCTTGAAGAACTTATTATGACTCATGTCTTCCATCTGCGCTAGCTTCTTTTTTTGCTGTGA
page-top