Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig532
Contig Information
Length 856 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10g13    rwhsd10g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 725
Evalue 9.61672e-75
Total Hit Count 164
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig532
GTTGAGAGCTTTGGAGATAAGTTGGTTGCTGAAATTAGCCGAGTGCTGAAAGCTGGTGGAATTGTGCTGGTACAGAGCTTCACACCCTCCACTGACCAGA
AGCCAAACAATTATATCGAGCGCCAGCTACTCATGGGTGGTTTTGTTGAAGTGCAAGCTTCTGCTACAAACTCGCAAGATAGCGTGCAATCTGTTACTAT
CAAGGCAAAGAAGCCTTCTTGGATTATGGGTTCTTCCTTTCCCCTGAAGAAAGCAGTAAAGGCTCTTCCAAAGATTGAAATTGACGATGATGATGAACTG
ATTGACGAAGACAGCCTCTTGACTGAGGAGGACTTGAAGAAGCCACAGCTTCCAGTTGTAGGAGATTGTGAGGTGGGAGCTACAAAGAAGGCATGCAAGA
ACTGCAGTTGTGGCAGGGCCGAGGCTGAGCAGAAGGTGGAGAAGCTGGGGCTCACTGCAGAACAGATTGATAACCCTGTCTCAGCTTGTGGCAGTTGTGG
GTTGGGCGACGCTTTCCGATGCAGCACCTGCCCATACAGAGGCCTGGCGCCGTTCAAGTTGGGCGAGAAGGTTACCTTGTCTGACAACTTCCTCTCAGCC
GACATATGATGACGGACAGCAGTTGCGGATATGAAATGCGCCTTGTTGGATTTGTTGGTTCGTTAGGAAGATATATCTGCGTATGGTTTTTTCGTGGTGA
TGGTGGTGGTGATGGTGGTTACAGCAAAAGAAGGGGAGTGCGTTTGGAGTAGCAGCTCGTGTTAGCATGTCGTGCGTGTCCTTGCTCTCCCACCTAGGTT
GAAGCAAGAATTGGATCGTGTGTGCGCCTCTGTATTCGGCAAGAAGATTACCATGC
page-top