Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig529
Contig Information
Length 588 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd7a18    rwhsd7a18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.18374e-26
Total Hit Count 341
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig529
GCCTCCTGCGCCTCCACTTCCATCGCCTCCCAAGATCGCAGATCTGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCGAGGTCGCCTGCACCCTTGCC
GCCCTCATCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGCCCGCGC
TCTTCGCCAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGCCCCGGC
TGCTGGTGGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTCGACTAA
GCAGTTCAATTCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCGGATTTAATATGTTTGAGACC
TAAGTATCTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAAAAAAAAAA
page-top