Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig502
Contig Information
Length 1284 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10d02    rwhsd10d02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00860 [Oryza sativa Indica Group]
Score 610
Evalue 3.87428e-61
Total Hit Count 204
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig502
GCACCCAGCGCGTCGACCCCATCCACAGTTGAATCTCTGAGTTTACTTTCAGAGAAGATTTTAGTCGAGATGGCGCAGGCGATCGAGGCTCAGAGGGAGG
GCGCGGAGGTGTACCACGGCGCGGCGCTGTGCGCGGAGAAGGCGGTGGAGCTGCTGGCCGAGACCAACATGCCGCTGGGCCTGCTGCCGCTGGCAGACAT
CGAGGAGGTGGGCTACAACCGCGCCACCGGCTTCGTCTGGCTGCGCCAGAAGAAGGCGCTCACGCACACCTTCAAGCAGATCGGGCGGCAGGTCTCGTAC
GGCACCGAGGTGACGGCCTTCGTCGAGGACCGCAAGATGAAGCGCATGACCGGGGTCAAGAGCAAGGAGCTCCTCATCTGGATCACCCTCTGCGACATGT
ACATCGAGAAGGACGATCCCTCCAAGATCACCTTCAAGACGCCCACAGGGCTGGGGAGGACCTTCCCCGTCTCCGCCTTCGAGAAGCAGGACGACGGCAA
GGCCAAGGCCGCGGCTGCCGACGGCAAGGAGGCCGTCGTGGCCAAGTAGGTGAGGACGGCCGGCATACTCTACAAAGTTTGGATGAAGAGTCCTCGAGTC
CAATATTAACTATATACAAAGTTTGGATGAAGAGTACTATTTGCTTTTATCTTTATAATAAACTACGGATTATATAAGGGGTTGTAATACTCTGCTCCGG
TGTTTTGCCGAGGGTTGTATCATGCATATGATCGTGCGATCTTTATAATCTTATATGTGCTGTTCGCTGCTTAAAAAAAAACCTCGTGCCGAATTCGGCA
CGAGGCGTCGGGAACCGCCTGCTCAGCGCCACCGTCGAGTATGAGGAGACGGGATGGTACGACGGGCAGATATGGGTTAAAACCCCAGAAGTTNTAGCTN
GTGATNGTNTTCTCGGATCATTTTCTGTGAAGCCGGTGCTGAACAGAGTGAAGTTCACCCTGGTGGGCCTGGCGGTGTCGCTGACCCTNTGCATCCTCCT
TTACGCCAACACCGAGAAGCCGAGGGAGCCGCTGGAGAACCCCGCCGGCGGGAGGGCCATCCCCGGGGTGTACAGTGACGCCGCCGTGAGGTCGTTCGAG
CCCGATGCCTTNTGCGGGGAGCCCGACCTCGGCGGCGGCGACCAGTNGTAACTTTNGACGGTGGTTNTGGTGGAAGGCGATGACAGGATCATNTATNTCA
TAGCATCCATCCTGTTCATCAGGGTGAAGTGGTGTAAATATCTAGCCGTACATAGCGATAGTCCATACGAAAAATGAAATCCCT
page-top