Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig321
Contig Information
Length 739 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10f18    rwhsd10f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0650100 [Oryza sativa (japonica cultivar-group)] >gi|51534981|dbj|BAD38105.1| polyubiquitin 2 [Oryza sativa Japonica Group] >gi|113596261|dbj|BAF20135.1| Os06g0650100 [Oryza sativa (japonica cultivar-group)] >gi|215692861|dbj|BAG88281.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218186299|gb|EEC68726.1| hypothetical protein OsI_37226 [Oryza sativa Indica Group] >gi|218198663|gb|EEC81090.1| hypothetical protein OsI_23921 [Oryza sativa Indica Group]
Score 675
Evalue 4.61111e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig321
GCGACCTAAACCTCCGCTCCGTCTCCGCGCAAAACCCTAGCGGATCCATCGACCTCGCGGAGAGGCGGAGAGCGGAGAGCGGAGAGAGGGAGTGGGTCCG
AAGATGCAGATCTTCGTGAAGACGCTGACCGGCAAGACCATCACGCTCGAGGTCGAGAGCAGCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACA
AGGAGGGCATTCCCCCAGATCAGCAAAGGCTAATTTTTGCTGGAAAGCAGTTGGAAGATGGGCGAACATTAGCTGATTACAACATTCAGAAAGAGTCGAC
GCTCCATTTGGTCCTGAGGCTCAGGGGTGGAACTATGATCAAGGTGAAGACACTTACTGGGAAGGAAATCGAGATTGATATTGAGCCCACTGACACAATC
GATAGAATCAAGGAACGTGTTGAGGAGAAAGAGGGTATTCCACCTGTTCAACAGAGGCTCATCTATGCTGGGAAGCAACTCGCTGATGACAAAACTGCTA
AGGACTACAACATTGAAGGTGGTTCAGTGCTCCATCTTGTGCTTGCTCTGAGGGGCGGTCAGTAGATGCAAAGTCGACGTGGGCCGTATAGGCCATTTCT
ACCAAAACTTGTTGCAGACCTAGATCTGTGAATTTGCCGGTTGATTGAAGTGCCATGTAATTGACGCATTTGTGAAGTCAGCTGTCACCTGTACTTGGAT
GGAATTGTTTGAACTATATGCTTATCTGTTGTCATCTGA
page-top