Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig38
Contig Information
Length 678 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhfl53h11    whfl53h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195659285|gb|ACG49110.1| 60S ribosomal protein L27a-3 [Zea mays]
Score 620
Evalue 9.13014e-63
Total Hit Count 410
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig38
ctcCCACACacctccgcct*cCACCCCACCCGTCCCGACCCctctcct*cCAAGGTAAGCCCGCGGCGGCGGCGAGCGAGCGAGCGGCGGCGATGACGAC
CCGCTTCAAGAAGAACCGGAAGAAGCGCGGCCACGTGTCCGCCGGGCACGGGCGTGTGGGCAAGCACCGCAAGCATCCCGGAGGCCGCGGTAACGCCGGA
GGCATGCACCACCACCGCATCCTCTTCGACAAGTACCATCCCGGCTACTTCGGCAAGGTCGGTATGCGCTACTTCCACAAGCTCAGCAACAGGTTCTACA
CACCGACGGTCAACGTCGAGAGGCTCTGGTCCATGGTTCCGTCCGACAAGGCGGCGGAGGCCGGCGGCGACAAGGCCCCCGTGGTCGACGTCTCGCAGTT
CGGCTACTTCAAGGTGCTCGGCAAGGGGATGCTGCCGGAGAAGCCCATCGTCGTCAAGGCCAAGCTCATCTCCAAGATCGCCgaaaagaagatcaaggcc
gccggcggcgcagtcgtgctcgttgcctagggttctgttcccgaccgtgccccgagatctatatctgaactattagttgtttcccgtaccagcaatttgt
gttgaagaagacatcgttagtttgttatcctggttcctgtgtggtaaaccaacatcttatgagaattttgcgctatgt
page-top