Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig167
Contig Information
Length 422 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10f07    rwhsd10f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BRAFLDRAFT_252522 [Branchiostoma floridae] >gi|210085869|gb|EEA34314.1| hypothetical protein BRAFLDRAFT_252522 [Branchiostoma floridae]
Score 79
Evalue 2.09573
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig167
CAACCTTTCTTTCTTTCTTGTATCCTATGTATACGCTGACTTGTCGTAGATTAGCTCGTACATAGTAGAATTTGTCAGTAGGCGGCTAGAGAACACACTG
CCTGACTTGGTACATGTTTGCCGTATACGTTGTTGCACTCTGTGTGGTTGCAAAGGTGTCAGTCAAGGATGTCCTAAGACACTCTTTTGTGTGCTTTCTT
GAACTGAGCATCGTTGCTGCAGTTTAGTTCACTGCCTCAGCAAAATGCTGTCGTCTTTCCGTACTAGATGGATTTATATTCAAAGGCATTTTGTAATTTT
TCGTACATTTTGGCTGAACTTCTGGCCATGTATGGACGATGGCTGGGCGAGTTCTTGCGTGATTTTTTCTGTGTAATAAATTACCGGCCGCTTGAAGTTT
GAAGCACTGTTCAAAAAAAAAA
page-top