Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig143
Contig Information
Length 1312 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10e24    rwhsd10e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_32217 [Oryza sativa Indica Group]
Score 481
Evalue 9.20442e-48
Total Hit Count 486
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig143
GCGGCGGTGGCAATGTGAGCACTCATAGCCAGAGCACTGGTAATTACAGTAGTGATGGGAACAGCAGCAGTGGTGGTGACGGTAACTGGAATGATGGGGG
TCTTAATGGTGGCAGCAACTTGAACTCTAGTGTTCATAGCGGCGCCATTGGTGGCAGTGGTATTGACAATAGTAGGAGAGTGTTCGGCAGTAACAATTGG
AATGGCAACGGTCGTGGTGGTGGCAGCTACAACAATGCCACCGGCAGTGGTGATGGGGGCAACAGATATAACGGCGGTAGTGGCAGCGGCCACTGGAACA
ATAATGCCCGACATGGTAGTGGTAATAGTAATGGCTTTGGTGCTCGTGGTGGTCGGAATCGCCGTGACCATGAAAGAGGGAGTAATTTCTCACCAAGGAA
CTATTCCCGTGCATTGCCAGTGCAGCAGCAGCAGCCGGGCTACTACCAGCCTGGACCATTTCAACGACCACCACCGCCATCACCTGCTGCTGCCCATTTC
ATGGTGCCACAACCTTTTGTGCCATATGTTCAACCCATTCCGTATCCTGCCGATTTACAAGGCTCCTATCCTTACTATGTCACACAAGTTGAGCAGCAGT
TTCAAAACATGCATCTTATCCGGCCGCCAATGCAGCCATTGGCGTTTCAGCAAGATCAAATTAATCTCCAACGTGACATTCAGCTGCAGATCGAGCACTA
TTTTAGCACTAATAATCTTTGCCACGACACATACTTGAGGGAACGTATGGATAATCAAGGATGGGTGCCTATTGATCTAATCGCTTCATTTCCTATGTTG
ACCAGGTTCACAATGTTGGGAATAGATACCAACTATATACTAGATTCTATCCGAGGCTCTGAGTTGTTGGAAGTGCAGGGAAATAATGTCCGAAGACGCA
ATGATTGGGCAGCATGGTTACTCCACCGAGGCCCACCACCTTCAAATTAGGTTCCGTGATGAAACAAAACTGCTTGTTATTGCTGGAGAAGCGATTAGAA
GAGATCGTCTGTTTGATTACGGGCAGGATATCCCGTGATAGATGGACCATGTATGTACAGCGGGGTTACATTTCCAGAGTCGGACGATTTTGTTTGTCTA
GGTCGGACATGATGGCTGCACTTGAAAAGCGCATTACAAAGCAGTAAGGGGGCAAACACAGCAATAAATAGGAAATAAATCCCAGAAGTGCAAATCCTTT
TTTTCTTTTGGCTGTATAGTTGTCTGAAAAGAAATTGTCGTTCCCTTGTTGCCATGGATGATGCGTCCTGAGGATTGTTGTGGATGATATATGGGGTTTA
TCTCACAGGATT
page-top