Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig100
Contig Information
Length 827 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd13d04    rwhsd13d04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mediator complex subunit 10 CG5057-PA [Zea mays] >gi|195639908|gb|ACG39422.1| mediator complex subunit 10 CG5057-PA [Zea mays]
Score 749
Evalue 1.48086e-77
Total Hit Count 133
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig100
CGTCTTCTGCCCCTCCGATTTCGCCATGGACAGCGCCGCCCCGAACTCTTCCTCCTCCGCCGCCGCAACCGCCGCCGTCGTAGCGGCTGCGGCCGCTTCC
GGTAACGGTGTACAAGGGGGCGACCGTCCGGAGGACCCGTCGAAGCAGAACCTGGCGCAGGTCACGGCCTCGATCCAGAGGACCCTGGGCCTGCTCCACC
AGCTCAACCTCAACGTCTCCTCCTTCAGCTCCGCGTCCCAGCTCCCCCTCCTCCAGCGCCTGAACGCGCTGGTGGCGGAGCTCGACACGATGCAGAAGCT
CGCCGAAGGGTGCAACATCCAGGTGCCCATGGAGGTCGTCAATTTGATCGATGACGGGAAGAACCCCGATGAGTTCACCCGGGACGTGCTCAACAGCTGC
ATCGCCAAGAACCAGATCACCAAGGGCAAGACCGATGCTTTCAAGAGTCTAAGGAAGCATCTTCTAGAGGAGCTTGAAGAAGCTTTTCCTGAAGACATTG
AAGCATACAGGCAGATACGTGCTACTTCTGCCGCTGAATCAAAGCGGTTGGCTCAGTCGCAAAATGTTTTGCCTAATGGAGATTCCAATGTGAAAGCTGA
GCACTGACATAAGGACGCAAGCCGCAAAGAGCAAGAAGCCCTGTAGCTCTCCTATGCTTACAGTGTGAGGAAGGCCCTGGGAACAAACAACTGATACTAT
ATATCCTTGTACGCACTGGCCTTTTATAGGAGGGATCAATAGTACATCTGTATATTATGTCACAATACTATATTCAACTTCCCATTTGTTGTAGTCAATG
CTACTCAGCTAGATTTGCCCGTGTTTT
page-top