Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig99
Contig Information
Length 715 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10n10    rwhsd10n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PP2Ac-2 - Phosphatase 2A isoform 2 belonging to family 2 [Zea mays]
Score 709
Evalue 4.8974e-73
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig99
TTCGACCGCATCCAAGAAGTCCCTCACGAGGGGCCAATGTGTGACCTTCTATGGTCTGATCCTGATGATCGATGTGGTTGGGGCATTTCACCACGTGGTG
CCGGATACACATTTGGCCAGGATATTTCAGAACAGTTTAACCATACCAATAGCCTTAAGCTAATAGCAAGAGCTCATCAGTTAGTTATGGAGGGATTCAA
CTGGGCACATGAGCAAAAGGTTGTGACAATATTTAGTGCACCTAACTACTGTTACCGGTGCGGTAACATGGCCTCGATCTTGGAGGTGGATGACTGCAGG
GAGCATACTTTCATCCAGTTTGAGCCTGCCCCAAGGAGAGGCGAGCCTGACGTGACCCGAAGGACGCCAGACTATTTCTTGTAAATGTAGCCTAGGCCAT
TCGTTTTTGTTTTATTTTACGGGATAGCTTAGGTTATTCCGACAGCAAACAAAAGAAAGCGCGTGATAGCTAGATGCGCCGTGTCCTGTCGTGTGGTCAT
AATTTTTGTTGTTTGGGTCTCGCTCTGTTTTGCTTCACTCCTTTTGTTGTAATCTGTGTGCTCATGCTGGGCTCAGGGGTGTGAATGTGATGGATGATGC
TGGTAAATCAAAGGCCCGGCGTAGTAGTAATTTTGTTGACTCCAAGTTGGCCTGTGTAGTATAACATGTGACGATGGCATTGGTGATTTTATGGATACAG
CTGAAGTCGTAAAAA
page-top