Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig98
Contig Information
Length 752 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd13d01    rwhsd13d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0460200 [Oryza sativa (japonica cultivar-group)] >gi|47900319|gb|AAT39166.1| putative ubiquitin-conjugating enzyme E2 [Oryza sativa (japonica cultivar-group)] >gi|113579306|dbj|BAF17669.1| Os05g0460200 [Oryza sativa (japonica cultivar-group)] >gi|125552611|gb|EAY98320.1| hypothetical protein OsI_20228 [Oryza sativa Indica Group] >gi|125594512|gb|EAZ34571.1| hypothetical protein OsJ_018054 [Oryza sativa (japonica cultivar-group)] >gi|215704345|dbj|BAG93779.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767219|dbj|BAG99447.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767276|dbj|BAG99504.1| unnamed protein product [Oryza sativa Japonica Group]
Score 756
Evalue 1.90749e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig98
TCCGGATTCCACCCTCCACCTCCAAACGCGCACGCGTCCACGAATAAAGGCCGAGGGCGGCGAGCCAGGCCCAATCGCCAAAAACCCTAGCGCCGATCCG
ATCCGATCGAGCTCTGCCTCCCCTCCCATGGCGGCCCCCCCGAGCCAGGCGAGCCTCCTGCTCCAGAAGCAGCTCCGAGATCTAGCGAAGAACCCCGTGG
ACGGGTTCTCGGCGGGGCTGGTGGACGACGGCAACGTGTTTGAGTGGCAGGTCACCATCATCGGCCCGCCGGAGACGTTATATGATGGAGGCTACTTCAA
TGCAGTAATGACCTTTCCTCAGGATTATCCCAACAGTCCTCCATCAGTAAGGTTTACTTCTGAGATGTGGCATCCAAACGTCTATCCTGATGGGCGTGTG
TGCATTTCTATTCTTCATCCACCTGGTGATGATCCGAATGGTTACGAGCTTGCAAGTGAACGGTGGACACCAGTGCACACAGTTGAGAGTATAGTTTTGA
GCATTATTTCGATGCTCTCTAGTCCAAACGATGAGTCTCCAGCAAATATTGAAGCGGCTAAGGACTGGAGAGAAAAGAGGGCCGAATTCAAGAAAAAGGT
GAGGAGCCTTGTTCGCAAATCTCAGGAAATGCTCTGAAAAAGGAGGATCATCCGGGGGAGTCCACAAGCGCTGCAATTCTCTTGCTTTCACCAAATGGGG
CACCTGATGCCAGCACTTGAACTTCTCCCCTGTTTATTTTCCGTTCAGCGTT
page-top