Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig97
Contig Information
Length 240 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10n12    rwhsd10n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group] (no hit)
Score 675
Evalue 5.83892e-69
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig97
TGATTTTGGTGTGTACATAAGGGTTAGCGCTATTGCACGTCTCAGCGCTCTAGCAACCTGTGCTGGTTGGTTCCATTGGCCATGCAACCTGAACCTTTAG
AAGAACATGGCCTAGCTGGGCAAAACGTCCCCTTATGCTGGCAGTAATATACTAGTAGTGCCAGCAGAACGTTTCGTGGTACCTGCGGTAACTTATAAGT
ACCTTAAAGCCCATCGTGTCTGAGATTTCTAAAAAAAAAA
page-top