Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig88
Contig Information
Length 884 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd13b08    rwhsd13b08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UDP-D-glucuronate decarboxylase [Hordeum vulgare]
Score 1105
Evalue 8.70411e-119
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig88
GCACCAGTGAGGTCTATGGTGATCCCCTCCAGCACCCTCAGGTGGAGACCTACTGGGGCAATGTCAACCCCATCGGTGTCAGGAGTTGCTACGATGAGGG
CAAGCGTACAGCTGAAACCTTGACCATGGACTACCACCGCGGTGCCAACCTTGAGGTTAGGATTGCTCGGATCTTTAACACCTATGGCCCGCGCATGTGC
ATTGACGATGGCCGTGTTGTCAGCAACTTTGTTGCTCAGGCGCTAAGGAAGGAGCCTTTGACGGTTTACGGCGATGGCAAGCAGACCAGGAGTTTCCAAT
ACGTTTCTGATTTGGTTGAGGGGTTGATGAGGCTGATGGAAGGTGACCACATAGGGCCATTCAACTTGGGTAACCCTGGTGAGTTCACCATGCTAGAGCT
GGCCAAGGTTGTCCAGGACACCATCGACCCGAATGCACGGATCGAGTTCCGTGAGAACACCCAGGACGACCCGCACAAGCGCAAGCCAGATATCACCAAG
GCCAAGGAGCAGCTCGGGTGGGAGCCGAAGATCGCCCTCCGTGACGGTCTTCCCCTCATGGTCACCGACTTCCGCAAGCGGATCTTCGGGGACCAAGATA
GCGCCGCCACCGCCACCGAAGGCCAGTAAAGAGTAGACCGGAGTACTATACTTTGAAATTTTGGTGGCCTGCTTCTAGCTTGCTTCTTGGTTAATCACCC
CACTGACAGAGCTATGGCCACGTAGTCGTTGAGAGTTTTACTGCTAAATACCTTGGTTGTTGATGTAATGTTATTCATTTTTGTCGTCGCCTTTTCCGCC
CGTCTCAGCTATACGGACACACATCCCAGTTGGATTGTTGGATATATAAATCTGGATCTTCTAATCCTTTGTTGATGAGATGAT
page-top