Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig87
Contig Information
Length 725 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10e14    rwhsd7j24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GK15034 [Drosophila willistoni] >gi|194160840|gb|EDW75741.1| GK15034 [Drosophila willistoni]
Score 101
Evalue 0.015981
Total Hit Count 94
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig87
TCGACCTCTCGCACACTCCCTCGACCTCGAGAAGGTCTTCTTCTCCACTTCCGGCTCCGTTCCGCCGCGGTACCCGAGAACCTCTCGTCGCCGTTAGGCC
ATCTTCGCCACCAAAACATCGTAAGTAGTCGTCTAGTCCACCATGTAGTCGATCCCGCGCCTCAATTCGTCAACCGGAGCCCTCTTCGGCGGGATCCGCC
ACCACCCGACGCCACCGTCCGCCGGAAACGACCTCGCCATCATTCTGGTGCTCGCCAGCGACAACCACCACCACCCACTGATGTGGGGTGCCACCCCGAG
CACATCCCAGCCATTGCCACCTCCTGAAACGCCGGCGATCGCCGCCGGTGACCACTGCACCCCCTCCGTACGCGCGCACGATCATGGGCTTGTCCCTGGC
TTGTTAATTTGGCCAGTCCTGGAGGAGGACGAGCTTGTGGAGGAAGGTTGCGCTAGCGAGCCCGACGCTTAGAGTTGTTCCTGGTTAGTCAACCGTGGTC
TTGGAGTCTACCACATGTATCATCCGCTGTGCTTTCGCTTCCCAAATAAAATAGTCAAGCCTCACTCTGATGCTTGGCTCTATTTTATTGTATCGGTGTT
GTACTACCATCAAACCACTGTCATATACCGCCACCACCATATATTGCAAATTTGTAATAAATAGTGGAGCACCCTGGCTCAACCCGATGTAATATTATGT
CGTACTGGTTATAAATATCAAGGAA
page-top