Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig84
Contig Information
Length 1273 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd10p23    rwhsd10p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0916400 [Oryza sativa (japonica cultivar-group)] >gi|19386752|dbj|BAB86133.1| putative selenium binding protein [Oryza sativa Japonica Group] >gi|20805006|dbj|BAB92682.1| putative selenium binding protein [Oryza sativa Japonica Group] >gi|31322241|gb|AAO91777.1| putative selenium binding protein [Oryza sativa (japonica cultivar-group)] >gi|113534725|dbj|BAF07108.1| Os01g0916400 [Oryza sativa (japonica cultivar-group)] >gi|125528845|gb|EAY76959.1| hypothetical protein OsI_04917 [Oryza sativa Indica Group] >gi|125573100|gb|EAZ14615.1| hypothetical protein OsJ_004440 [Oryza sativa (japonica cultivar-group)]
Score 1966
Evalue 0
Total Hit Count 224
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig84
TTCGTTGCTGTCTGGTCGCGTGTATGTGGTCGACACTGCAAAGGATCCGAGGGCGCCTGCTCTGCACAAGGTTGTCCAGGCTGAGGACATTGCTGAGAAG
ACCGGGCTTGGGTTCCCTCACACATCCCATTGCCTTGCAACTGGGGATATCATGATTTCCTGCCTGGGAGACAAGGAGGGCAATGCTGCTGGCAATGGCT
TTCTCCTGTTGGATTCAGAGTTTAACGTCAAAGGGCGTTGGGAAAAGCCAGGTCACAGCCCCTTGTTTGGCTATGATTTCTGGTACCAGCCTCGTCACAA
GACGATGATTAGCTCTTCATGGGGAGCTCCGGCAGCTTTCAGGACAGGTTTCGATCTCCAGCATGTCCAGGATGGTCTCTATGGAAGGCACCTGCATGTG
TATGACTGGCCTGGTGGTGAGCTCAAGCAGACACTGGATCTAGGCAGCACAGGTCTTCTTCCACTGGAGGTGAGGTTTTTACATGACCCATCAAAGGACA
CTGGCTATGTTGGCTGTGCTTTGACAAGCAACATGGTGAGATTCTTCAAAACTGCAGATGGATCATGGAGCCATGAGGTAGCTATATCCATAGAGCCACT
GAAGGTGCGCAACTGGATGCTGCCAGAAATGCCAGGATTGATAACTGACTTTGTCATCTCTCTCGATGACCGTTATCTCTACTTGGTCAACTGGCTTCAT
GGGGATATCAGGCAGTACAACATTGAGGACCCTGCAAAGCCTGTGTTGGCTGGGCAAGTATTTGTAGGTGGGCTTCTTCAAAAGGGCAGTGATGTTGTCT
ATGTGACCGACGATGACAAAGAAGAGCAGTATGCTGTGCCCCAAGTCAAGGGGCACCGGCTTAGAGGTGGGCCGCAGATGATTCAGCTGAGCTTGGATGG
CAAGAGGGTCTATGTAACCAACTCTCTCTTCAGCCGATGGGACGAGCAGTTCTATGGCCCTGACCTTCTCAAGAAGGGATCTCACATGTTGCAGATCGAC
GTCGACACCGAGGAAGGAGGGCTGACTGTCAACCCCGACTTCTTTGTGGATTTTGGCACCGAGCCTGAAGGTCCCTCATTGGCCCATGAAATGAGATATC
CTGGGGGAGACTGCACCTCTGACATATGGATCTAGGACGAAGGGTGTAGGGTGCATATGCAGCTGGAGATCCATGGTGTTAAGCTCACTGTAATTAAGAT
GGTTTCTTCCCTGCCTGCGGTGTTGTATGTGATGTGGTATCAATTGGAATAAGTTCCTGATAGAACCTCTGAC
page-top