Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_SHDr_all.Contig83
Contig Information
Length 717 bp
Tissue Shoot grown with dessication
Clones 2 Clones [Download: CSV  ,  FASTA ]
whsd1a12    rwhsd1a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0360700 [Oryza sativa (japonica cultivar-group)] >gi|108708283|gb|ABF96078.1| Peptide methionine sulfoxide reductase msrB, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548627|dbj|BAF12070.1| Os03g0360700 [Oryza sativa (japonica cultivar-group)] >gi|125586334|gb|EAZ26998.1| hypothetical protein OsJ_010481 [Oryza sativa (japonica cultivar-group)] >gi|215697082|dbj|BAG91076.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215766583|dbj|BAG98742.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192874|gb|EEC75301.1| hypothetical protein OsI_11657 [Oryza sativa Indica Group]
Score 687
Evalue 1.74185e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_SHDr_all.Contig83
CCCTCCCTGCCTCCCTCCTCGGCGCTCCGCCGGCTTCGTGCTCCCTGCGTTCGCCGCGCGCGCGAGCGCGACCGATGGCGTCCGGCGACAGCAAGCCGAG
GAGCGAGGAGGAGTGGCGTGCCGTCCTCTCCCCCGAGCAGTTCCGCATCCTCCGCCTCAAGGGCACCGAGTTACCGGGAACAGGCGAGTACAACAAGTTC
TACGGTGACGGGGCGTACAACTGCGTTGGCTGCGGAACGCCCCTGTACAAGTCCACCACCAAATTCGACTCCGGCTGTGGCTGGCCGGCCTTCTTCGAGG
GGCTCCCTGGAGCCATACACAGGACGCCTGACCCTGATGGTAGGAGGGTAGAGATCACATGCGCATCTTGCGGCGGGCATTTGGGACATGTGTTCAAGGG
AGAAGGCTTCAAGACGCCTACCGATGAGCGCCACTGCGTCAACAGCGTTTCCATCAAGTTCACTCCTGCCTCCTCCTGAATCCGGCCAGTTCTCGAGTCA
TCTGGATGAACTTGTTTAAACAAATGCATAATAATGATTAGGTTCCAGAATCCGTTCTCTCGAAGTTGTGTGGATGAATTTCCCTGATCCGAAACTGCGG
AAAGCAGGTAAATAAAACATGGATAGGATCTTGCAAGTTTCTACTGTTAACCAGGCTATGATCTTGTAACTTGCATTGCCATGAACTGTGACCTAATCTG
TTCGGTCTGAAAAAAAA
page-top